Gene detail

Detail information of GWHGAAZE021757

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004234013.1	4.21162E-56	PREDICTED: ferredoxin, root R-B2 [Solanum lycopersicum]
COG	NP_484827.1	8E-25	ferredoxin
Swissprot	tr\|P14937\|FER2_RAPSA	3E-23	Ferredoxin, root R-B2
trEMBL	tr\|A0A061ETU0\|A0A061ETU0_THECC	2E-56	2Fe-2S ferredoxin-like superfamily protein {ECO:0000313\|EMBL:EOY05689.1} (Fragment)
TAIR10	AT4G14890.1	4E-42	2Fe-2S ferredoxin-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	60835540	60835836	+
GWHAAZE00000006	mRNA	60835540	60835836	+
GWHAAZE00000006	exon	60835540	60835836	+
GWHAAZE00000006	CDS	60835540	60835836	+

Transcript Sequence
>GWHTAAZE021781 ATGGAACACGAAGGCAAAACAACCGAGCTGAGTGTGGATGAAGACGAGACAATTCTATCCAAGGCACTAGACTCCGGCCTCAACGTGCCGCATGACTGCAAGCTCGGTGTGTGCATGACTTGCCCGGCAAAGCTTCTGAGTGGCGACGTCGATCAGAGCGACGGCATGCTGAGTGACGACGTCATTGAGAAGGGATTCGCGCTATTGTGCGCGGCGTATCCGAGATCTGATTGTCACATTAGGACTATCCCGGAGGAAGAGTTGCTGTCTATGCAATTAGCCACTGCTGACGACTGA

Network for GWHGAAZE021757

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00111.28	Fer2	3	74	9.50E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02639	petF	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0022900	biological_process	electron transport chain
GO:0009055	molecular_function	electron transfer activity
GO:0051537	molecular_function	2 iron, 2 sulfur cluster binding
GO:0051536	molecular_function	iron-sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.671
	SRR3591706	second leaf	149.400
	SRR3591707	mature leaf	173.294
	SRR3591708	Shoot apex	90.328
	SRR3591709	Stem	26.287
	SRR3591710	White floral bud	7.180
	SRR3591711	White flower	10.993
	SRR3591712	Green floral bud	5.786
	SRR3591713	Yellow flower	3.424
SRP173429	SRR8316895	Juvenile bud stage	12.745
	SRR8316896	Juvenile bud stage	11.915
	SRR8316897	Juvenile bud stage	13.973
	SRR8316894	Third green stage	4.721
	SRR8316900	Third green stage	8.076
	SRR8316901	Third green stage	10.433
	SRR8316898	Complete white stage	4.142
	SRR8316899	Complete white stage	6.943
	SRR8316903	Complete white stage	5.082
	SRR8316902	Silver flowering stage	0.976
	SRR8316904	Silver flowering stage	2.165
	SRR8316905	Silver flowering stage	1.233
	SRR8316906	Gold flowering stage	1.569
	SRR8316907	Gold flowering stage	1.480
	SRR8316908	Gold flowering stage	3.423
SRP132670	SRR6706286	Control	16.892
	SRR6706287	Light intensity 50%	8.149
	SRR6706288	Light intensity 20%	9.112
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.097
	CNS0095593	Slightly white alabastrum(diploid) 2	14.479
	CNS0095594	Slightly white alabastrum(diploid) 3	11.773
	CNS0095595	Whole white alabastrum(diploid) 2	8.813
	CNS0095596	Whole white alabastrum(diploid) 3	6.097
	CNS0095597	Whole white alabastrum(diploid) 4	6.530
	CNS0095598	Silvery flower (diploied) 1	28.329
	CNS0095599	Silvery flower (diploied) 2	22.180
	CNS0095600	Silvery flower (diploied) 3	7.266
	CNS0095601	Golden flower (diploid) 1	21.176
	CNS0095602	Golden flower (diploid) 2	16.700
	CNS0095603	Golden flower (diploid) 3	11.577
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.543
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.164
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.335
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.668
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.328
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.880
	CNS0095610	Silvery flower (tetraploid) 1	2.835
	CNS0095611	Silvery flower (tetraploid) 2	4.663
	CNS0095612	Silvery flower (tetraploid) 3	9.595
	CNS0095613	Golden flower (tetraploid) 1	6.103
	CNS0095614	Golden flower (tetraploid) 2	2.419
	CNS0095615	Golden flower (tetraploid) 3	4.636
CRA001975	CRR073297	Stem 1	63.685
	CRR073298	Stem 2	61.114
	CRR073299	Stem 3	104.453
	CRR073300	Leaf 1	21.195
	CRR073301	Leaf 2	30.933
	CRR073302	Leaf 3	33.179
	CRR073303	Juvenile bud 1	22.660
	CRR073304	Juvenile bud 2	15.601
	CRR073305	Juvenile bud 3	39.011
	CRR073306	Third green 1	5.169
	CRR073307	Third green 2	5.414
	CRR073308	Third green 3	8.803
	CRR073309	Second white 1	6.554
	CRR073310	Second white 2	4.125
	CRR073311	Second white 3	6.437
	CRR073312	Silver flowering 1	4.115
	CRR073313	Silver flowering 2	6.840
	CRR073314	Silver flowering 3	5.355
	CRR073315	Gold flowering 1	443.962
	CRR073316	Gold flowering 2	369.901
	CRR073317	Gold flowering 3	516.326
	CRR073318	Tawny withering 1	71.148
	CRR073319	Tawny withering 2	67.627
	CRR073320	Tawny withering 3	79.700