Gene detail

Detail information of GWHGAAZE021013

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011099683.1	9.7062E-131	PREDICTED: NAC domain-containing protein 2-like [Sesamum indicum]
Swissprot	tr\|Q9C598\|NAC81_ARATH	2E-111	Protein ATAF2
trEMBL	tr\|A7LKM8\|A7LKM8_AVIMR	4E-131	Putative NAC transcription factor {ECO:0000313\|EMBL:ABS80935.1}
TAIR10	AT5G08790.1	1E-90	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	31158020	31159598	-
GWHAAZE00000006	mRNA	31158020	31159598	-
GWHAAZE00000006	exon	31158020	31158514	-
GWHAAZE00000006	exon	31158730	31159010	-
GWHAAZE00000006	exon	31159433	31159598	-
GWHAAZE00000006	CDS	31159433	31159598	-
GWHAAZE00000006	CDS	31158730	31159010	-
GWHAAZE00000006	CDS	31158020	31158514	-

Transcript Sequence
>GWHTAAZE021037 ATGAAAGGTGGTAATCAATTGGATTTACCGGCCGGATTTAGATTCCATCCGACCGACGAGGAGCTTGTCTTACATTACTTGTGCCGTAAATGTGCCTCCCAGTCGATTGCGGTTCCGATTATTGCTGAAATTGATCTTTACAAGTTTGATCCATGGCAACTTCCAGGATTGGCAATGTATGGTGAAAAGGAATGGTACTTTTTCTCGCCGAGGGACAGAAAGTACCCCAATGGTTCGCGGCCAAACAGGGCTGCCGGAACAGGGTACTGGAAGGCCACCGGAGCCGATAAGCCGGTGGGTAAACCCAAGACTTTGGGCATTAAAAAGGCGCTAGTGTTCTACGCCGGAAAAGCACCTAAAGGCATCAAAACAAATTGGATCATGCATGAATATCGCTTAGCTAATGTGGATCGATCCGCTGGTGCCGGAAAGAAAAATAATTCAAGGCTAGATGATTGGGTATTATGTCGAATATACAACAAGAAAGGTACCATTGAGAAGCACTACAATGTGGTGGATAAAAATTTGGATGCATCATATATAGAAGACAAGAAACCCCAAATTTCAACATTGGGCTATGATCATGTAAATTTCACAAAGATGCAGCCACCACAACAGCAGCCGCCTGTGGTAGCACAAACAGCGAACAACAGTGACTCCTACTACAATTTCCAAACATCGTCGTCATCGGAATATTCGATGCAACCGCCGAGGTTAAATGGCTATTCTAGTTCGTCGTCGGGACTAGCGGAGTTGACATTTGAGAAGGAAATTGAGGTCCAAAGCGATCCAAAATGGAATAACAATAACAGTAATATTGGTTTTGATTTTGATTTTGAGCTTAGTGATTACATGGATACATTTGCAAATGACCCTTTTGACCCTCAAATCCAGTATAGTGACTACCAGGATGCGTCCATGTACATGCAAAATCCTTTCTAG

Network for GWHGAAZE021013

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	10	133	8.40E-38

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.546
	SRR3591706	second leaf	13.120
	SRR3591707	mature leaf	2.663
	SRR3591708	Shoot apex	21.020
	SRR3591709	Stem	24.357
	SRR3591710	White floral bud	34.513
	SRR3591711	White flower	35.171
	SRR3591712	Green floral bud	28.858
	SRR3591713	Yellow flower	34.508
SRP173429	SRR8316895	Juvenile bud stage	138.107
	SRR8316896	Juvenile bud stage	132.438
	SRR8316897	Juvenile bud stage	138.653
	SRR8316894	Third green stage	15.687
	SRR8316900	Third green stage	28.313
	SRR8316901	Third green stage	83.901
	SRR8316898	Complete white stage	7.867
	SRR8316899	Complete white stage	97.749
	SRR8316903	Complete white stage	10.436
	SRR8316902	Silver flowering stage	12.820
	SRR8316904	Silver flowering stage	24.331
	SRR8316905	Silver flowering stage	11.278
	SRR8316906	Gold flowering stage	41.781
	SRR8316907	Gold flowering stage	31.701
	SRR8316908	Gold flowering stage	72.353
SRP132670	SRR6706286	Control	17.537
	SRR6706287	Light intensity 50%	23.678
	SRR6706288	Light intensity 20%	17.836
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	118.313
	CNS0095593	Slightly white alabastrum(diploid) 2	208.431
	CNS0095594	Slightly white alabastrum(diploid) 3	205.408
	CNS0095595	Whole white alabastrum(diploid) 2	192.395
	CNS0095596	Whole white alabastrum(diploid) 3	27.058
	CNS0095597	Whole white alabastrum(diploid) 4	113.418
	CNS0095598	Silvery flower (diploied) 1	179.656
	CNS0095599	Silvery flower (diploied) 2	386.549
	CNS0095600	Silvery flower (diploied) 3	98.805
	CNS0095601	Golden flower (diploid) 1	310.479
	CNS0095602	Golden flower (diploid) 2	194.924
	CNS0095603	Golden flower (diploid) 3	191.003
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.742
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.036
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.254
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.745
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.764
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.580
	CNS0095610	Silvery flower (tetraploid) 1	32.881
	CNS0095611	Silvery flower (tetraploid) 2	35.070
	CNS0095612	Silvery flower (tetraploid) 3	16.030
	CNS0095613	Golden flower (tetraploid) 1	30.871
	CNS0095614	Golden flower (tetraploid) 2	30.941
	CNS0095615	Golden flower (tetraploid) 3	21.710
CRA001975	CRR073297	Stem 1	47.595
	CRR073298	Stem 2	75.159
	CRR073299	Stem 3	42.736
	CRR073300	Leaf 1	93.468
	CRR073301	Leaf 2	152.416
	CRR073302	Leaf 3	42.743
	CRR073303	Juvenile bud 1	36.415
	CRR073304	Juvenile bud 2	76.803
	CRR073305	Juvenile bud 3	65.120
	CRR073306	Third green 1	24.676
	CRR073307	Third green 2	18.307
	CRR073308	Third green 3	24.374
	CRR073309	Second white 1	5.521
	CRR073310	Second white 2	13.501
	CRR073311	Second white 3	10.676
	CRR073312	Silver flowering 1	21.259
	CRR073313	Silver flowering 2	13.956
	CRR073314	Silver flowering 3	7.344
	CRR073315	Gold flowering 1	13.952
	CRR073316	Gold flowering 2	41.562
	CRR073317	Gold flowering 3	22.307
	CRR073318	Tawny withering 1	25.671
	CRR073319	Tawny withering 2	157.797
	CRR073320	Tawny withering 3	16.548