Gene detail

Detail information of GWHGAAZE020787

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004159578.1	3.07249E-53	PREDICTED: acyl-[acyl-carrier-protein] desaturase, chloroplastic-like [Cucumis sativus]
Swissprot	tr\|P22243\|STAD_CARTI	1E-54	Acyl-[acyl-carrier-protein] desaturase, chloroplastic (Precursor)
trEMBL	tr\|F1DG97\|F1DG97_JATCU	1E-52	Acyl-[acyl-carrier-protein] desaturase {ECO:0000256\|RuleBase:RU000582} (Fragment)
TAIR10	AT2G43710.2	1E-39	Plant stearoyl-acyl-carrier-protein desaturase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	21082991	21083305	+
GWHAAZE00000006	mRNA	21082991	21083305	+
GWHAAZE00000006	exon	21082991	21083305	+
GWHAAZE00000006	CDS	21082991	21083305	+

Transcript Sequence
>GWHTAAZE020811 ATGATGAGGAAAAGAATCGCAATGCCGGCCCACTTAATGTGTGATGGTCGTGATGACAACCTTTTCCAGCACTTCTCGGCTGTGGCTCAGCGACTCAGGGTCTACACTGCGAAGGACTATGCAGATATATTGGAGCATTTGATTAAAAGGTGGAACGTAGCGGATCTAACTGGCCTTTCGGGTAGAGGGCAAGAAGCTCAACACTATGTTTGCGAGTTACCTTCGAAAATTAGAAGGATCGAGGAGAGAACTCGAGGAAGGGCGAAAGAGGGACCTGCAGTTCCGTTTAGCTGGATATCTGATAGAAAAGTGTAA

Network for GWHGAAZE020787

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03405.15	FA_desaturase_2	1	99	1.80E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03921	FAB2, SSI2, desA1	Metabolic pathways	map01100
		Fatty acid metabolism	map01212
		Fatty acid biosynthesis	map00061
		Biosynthesis of unsaturated fatty acids	map01040

Gene Ontology

GO term	Ontology	Name
GO:0006633	biological_process	fatty acid biosynthetic process
GO:0055114	biological_process	oxidation-reduction process
GO:0006631	biological_process	fatty acid metabolic process
GO:0016491	molecular_function	oxidoreductase activity
GO:0045300	molecular_function	acyl-[acyl-carrier-protein] desaturase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.101
	SRR3591706	second leaf	0.255
	SRR3591707	mature leaf	0.327
	SRR3591708	Shoot apex	0.235
	SRR3591709	Stem	3.666
	SRR3591710	White floral bud	0.535
	SRR3591711	White flower	0.061
	SRR3591712	Green floral bud	0.270
	SRR3591713	Yellow flower	0.123
SRP173429	SRR8316895	Juvenile bud stage	0.362
	SRR8316896	Juvenile bud stage	0.996
	SRR8316897	Juvenile bud stage	0.134
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.145
	SRR8316901	Third green stage	0.340
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.603
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.058
	SRR8316904	Silver flowering stage	0.368
	SRR8316905	Silver flowering stage	0.046
	SRR8316906	Gold flowering stage	0.118
	SRR8316907	Gold flowering stage	0.489
	SRR8316908	Gold flowering stage	0.161
SRP132670	SRR6706286	Control	0.162
	SRR6706287	Light intensity 50%	0.081
	SRR6706288	Light intensity 20%	0.172
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.165
	CNS0095593	Slightly white alabastrum(diploid) 2	0.305
	CNS0095594	Slightly white alabastrum(diploid) 3	0.368
	CNS0095595	Whole white alabastrum(diploid) 2	0.947
	CNS0095596	Whole white alabastrum(diploid) 3	0.053
	CNS0095597	Whole white alabastrum(diploid) 4	0.056
	CNS0095598	Silvery flower (diploied) 1	0.233
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.088
	CNS0095601	Golden flower (diploid) 1	0.184
	CNS0095602	Golden flower (diploid) 2	0.164
	CNS0095603	Golden flower (diploid) 3	0.425
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.052
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.093
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.463
	CRR073298	Stem 2	0.208
	CRR073299	Stem 3	0.538
	CRR073300	Leaf 1	0.123
	CRR073301	Leaf 2	0.181
	CRR073302	Leaf 3	0.512
	CRR073303	Juvenile bud 1	0.468
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.461
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.255
	CRR073313	Silver flowering 2	0.379
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.237
	CRR073316	Gold flowering 2	1.564
	CRR073317	Gold flowering 3	0.108
	CRR073318	Tawny withering 1	0.944
	CRR073319	Tawny withering 2	0.371
	CRR073320	Tawny withering 3	1.049