Gene detail

Detail information of GWHGAAZE020599

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHF22089.1	2.2568E-102	CYP79D33 [Maesa lanceolata]
COG	YP_003102278.1	3E-17	cytochrome P450
Swissprot	tr\|Q6J541\|C79D3_LOTJA	8E-97	Isoleucine N-monooxygenase 1
trEMBL	tr\|A0A067LLP6\|A0A067LLP6_JATCU	4E-101	Uncharacterized protein {ECO:0000313\|EMBL:KDP45690.1}
TAIR10	AT2G22330.1	3E-79	cytochrome P450, family 79, subfamily B, polypeptide 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	12146103	12146878	+
GWHAAZE00000006	mRNA	12146103	12146878	+
GWHAAZE00000006	exon	12146103	12146426	+
GWHAAZE00000006	exon	12146516	12146878	+
GWHAAZE00000006	CDS	12146103	12146426	+
GWHAAZE00000006	CDS	12146516	12146878	+

Transcript Sequence
>GWHTAAZE020623 ATGCAAGATGGAGGACCAGGAGCTGAAGAAGAAGAGCATATCAACGCGATCTTCTCAATACTTAAGTACACATTTTCTTTTTGTGTTTCTGATTATGTTGGATTTTTACGTGGACGGTTTGATTTAGATGGTCAAGAAAAAAACATCAGAAAGGCAGTTGAAAGTGTGAGGAAGTATCATGATCCTTTAATAGACAAGAGAGCTCAACAATGGGCGAAAGGAACCAAGACAGTGAAAGAAGACTTGCTTGATGTCATGATCTCTCTCCAGAGTGAAGCGGGCATGACTTTATTGTCCGTTGATGAGATTAAAGCCCAAGTTATTGAAATGATGCTGGCATCGGTGGACAATCCATCGAATGCAGTTGAGTGGGCACTTGCAGAAATGATAAATCAAACTGAGACACTTCAAAGGGCAGTAGAAGAATTAGATAGAGTGGTAGGGGCACACAGGTTGGTCCAGGAATCAGATTTGCCAAAGCTGAACTACATTAAGTCATGTATAAGGGAGGCCTTTAGACTCCATCCTTTTGTAGCTTTTAACGTCCCGCATGTATCCATGTCTGATACGACAGTCGCTGGCTACTTCATACCAAAGGGTAGCCATGTTATTTTGAGTCGATCAGGTCTTGGACACAACCCTAAAATCTGGGGCGACCCATCGACCTTTAATCGAGGCGACACTTGA

Network for GWHGAAZE020599

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	39	224	7.30E-47

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12153	CYP79A2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Cyanoamino acid metabolism	map00460
		Glucosinolate biosynthesis	map00966

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.413
	SRR3591711	White flower	0.827
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	1.223
SRP173429	SRR8316895	Juvenile bud stage	0.017
	SRR8316896	Juvenile bud stage	0.066
	SRR8316897	Juvenile bud stage	0.440
	SRR8316894	Third green stage	0.014
	SRR8316900	Third green stage	0.064
	SRR8316901	Third green stage	0.052
	SRR8316898	Complete white stage	0.905
	SRR8316899	Complete white stage	0.136
	SRR8316903	Complete white stage	0.300
	SRR8316902	Silver flowering stage	356.414
	SRR8316904	Silver flowering stage	477.656
	SRR8316905	Silver flowering stage	324.101
	SRR8316906	Gold flowering stage	939.254
	SRR8316907	Gold flowering stage	977.207
	SRR8316908	Gold flowering stage	487.331
SRP132670	SRR6706286	Control	0.052
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.004
	CNS0095593	Slightly white alabastrum(diploid) 2	0.441
	CNS0095594	Slightly white alabastrum(diploid) 3	0.205
	CNS0095595	Whole white alabastrum(diploid) 2	0.343
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.029
	CNS0095598	Silvery flower (diploied) 1	22.146
	CNS0095599	Silvery flower (diploied) 2	28.301
	CNS0095600	Silvery flower (diploied) 3	224.221
	CNS0095601	Golden flower (diploid) 1	52.405
	CNS0095602	Golden flower (diploid) 2	125.095
	CNS0095603	Golden flower (diploid) 3	123.983
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.080
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.035
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.254
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	75.536
	CNS0095611	Silvery flower (tetraploid) 2	173.022
	CNS0095612	Silvery flower (tetraploid) 3	1544.107
	CNS0095613	Golden flower (tetraploid) 1	106.672
	CNS0095614	Golden flower (tetraploid) 2	54.510
	CNS0095615	Golden flower (tetraploid) 3	258.030
CRA001975	CRR073297	Stem 1	1.422
	CRR073298	Stem 2	1.473
	CRR073299	Stem 3	1.245
	CRR073300	Leaf 1	0.832
	CRR073301	Leaf 2	1.587
	CRR073302	Leaf 3	2.329
	CRR073303	Juvenile bud 1	1.256
	CRR073304	Juvenile bud 2	1.110
	CRR073305	Juvenile bud 3	0.999
	CRR073306	Third green 1	1302.672
	CRR073307	Third green 2	653.051
	CRR073308	Third green 3	843.807
	CRR073309	Second white 1	1986.596
	CRR073310	Second white 2	1676.837
	CRR073311	Second white 3	1819.094
	CRR073312	Silver flowering 1	1403.342
	CRR073313	Silver flowering 2	1254.962
	CRR073314	Silver flowering 3	1016.037
	CRR073315	Gold flowering 1	0.347
	CRR073316	Gold flowering 2	0.769
	CRR073317	Gold flowering 3	0.079
	CRR073318	Tawny withering 1	0.192
	CRR073319	Tawny withering 2	1.134
	CRR073320	Tawny withering 3	0.073