Gene detail

Detail information of GWHGAAZE020384

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10060.1	2.36914E-86	unnamed protein product [Coffea canephora]
COG	YP_007118813.1	5E-14	putative signal transduction protein with EFhand domain
Swissprot	tr\|O22845\|CML5_ARATH	6E-66	Calmodulin-like protein 5
trEMBL	tr\|A0A068UNE4\|A0A068UNE4_COFCA	9E-87	Coffea canephora DH200=94 genomic scaffold, scaffold_42 {ECO:0000313\|EMBL:CDP10060.1}
TAIR10	AT1G05990.1	2E-42	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	2919201	2919846	+
GWHAAZE00000006	mRNA	2919201	2919846	+
GWHAAZE00000006	exon	2919201	2919444	+
GWHAAZE00000006	exon	2919515	2919846	+
GWHAAZE00000006	CDS	2919201	2919444	+
GWHAAZE00000006	CDS	2919515	2919846	+

Transcript Sequence
>GWHTAAZE020406 ATGCCATCTGTTTTGTTAAGAACATTTCTTCTTTACAATCTCCTTAATACAATTCTCCTCTACTTGATCCCCAAGAAACTTAGATCCTACCTCCCACCTTCTTGGTACACACCCACTACCACCACAGTCGCGGCCGCAACCGCAACCGCACCCACCAAGTCACCACCACCGGCGTCGGCTCAGGGTTTACGCCGGATGGACGCGGACGAGCTTCGGCGGGTCTTCCAAATGTTTGACCAAAACGAGCTCAATCAAATGATTGAGAAGATAGACGTGAACAACGATGGGTGCGTAGACATTGATGAGTTTGGGGAGTTGTATCAGTCTATAATGGACGGTCGCGATGAGGATGAGGATATGAGGGAAGCGTTTAACGTGTTTGATCAAAATGGGGACGGGTTCATCACCGTTGATGAGTTGAAATCAGTATTGGGATCACTCGGGCTTAAGCAAGGGCGGACCGCGGAGGATTGCAAGAGCATGATCAATAAGGTAGATGTTGATGGTGATGGGAGAGTAGATTTTAATGAGTTTAAGCAAATGATGAGAGGGGGTGGATTTGCAGCATTGACTTGA

Network for GWHGAAZE020384

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00036.33	EF-hand_1	82	108	2.80E-06
PF13499.7	EF-hand_7	118	183	2.40E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	162.924
	SRR3591706	second leaf	28.397
	SRR3591707	mature leaf	16.797
	SRR3591708	Shoot apex	75.009
	SRR3591709	Stem	104.144
	SRR3591710	White floral bud	288.060
	SRR3591711	White flower	93.960
	SRR3591712	Green floral bud	257.266
	SRR3591713	Yellow flower	38.573
SRP173429	SRR8316895	Juvenile bud stage	113.381
	SRR8316896	Juvenile bud stage	181.416
	SRR8316897	Juvenile bud stage	80.581
	SRR8316894	Third green stage	39.204
	SRR8316900	Third green stage	165.631
	SRR8316901	Third green stage	184.075
	SRR8316898	Complete white stage	2.417
	SRR8316899	Complete white stage	135.641
	SRR8316903	Complete white stage	2.188
	SRR8316902	Silver flowering stage	8.148
	SRR8316904	Silver flowering stage	8.941
	SRR8316905	Silver flowering stage	5.723
	SRR8316906	Gold flowering stage	17.746
	SRR8316907	Gold flowering stage	13.652
	SRR8316908	Gold flowering stage	8.945
SRP132670	SRR6706286	Control	198.475
	SRR6706287	Light intensity 50%	187.598
	SRR6706288	Light intensity 20%	148.931
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	223.301
	CNS0095593	Slightly white alabastrum(diploid) 2	215.320
	CNS0095594	Slightly white alabastrum(diploid) 3	270.012
	CNS0095595	Whole white alabastrum(diploid) 2	432.761
	CNS0095596	Whole white alabastrum(diploid) 3	426.393
	CNS0095597	Whole white alabastrum(diploid) 4	582.191
	CNS0095598	Silvery flower (diploied) 1	204.759
	CNS0095599	Silvery flower (diploied) 2	220.726
	CNS0095600	Silvery flower (diploied) 3	70.895
	CNS0095601	Golden flower (diploid) 1	137.430
	CNS0095602	Golden flower (diploid) 2	108.964
	CNS0095603	Golden flower (diploid) 3	107.424
	CNS0095604	Slightly white alabastrum(tetraploid) 1	254.094
	CNS0095605	Slightly white alabastrum(tetraploid) 2	295.174
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.547
	CNS0095607	Whole white alabastrum(tetraploid) 1	523.669
	CNS0095608	Whole white alabastrum(tetraploid) 2	610.479
	CNS0095609	Whole white alabastrum(tetraploid) 3	285.103
	CNS0095610	Silvery flower (tetraploid) 1	10.159
	CNS0095611	Silvery flower (tetraploid) 2	25.489
	CNS0095612	Silvery flower (tetraploid) 3	73.021
	CNS0095613	Golden flower (tetraploid) 1	13.078
	CNS0095614	Golden flower (tetraploid) 2	5.259
	CNS0095615	Golden flower (tetraploid) 3	29.806
CRA001975	CRR073297	Stem 1	133.265
	CRR073298	Stem 2	157.611
	CRR073299	Stem 3	157.862
	CRR073300	Leaf 1	308.046
	CRR073301	Leaf 2	309.459
	CRR073302	Leaf 3	162.041
	CRR073303	Juvenile bud 1	209.231
	CRR073304	Juvenile bud 2	269.799
	CRR073305	Juvenile bud 3	164.527
	CRR073306	Third green 1	209.317
	CRR073307	Third green 2	289.399
	CRR073308	Third green 3	221.476
	CRR073309	Second white 1	174.704
	CRR073310	Second white 2	128.434
	CRR073311	Second white 3	133.267
	CRR073312	Silver flowering 1	277.599
	CRR073313	Silver flowering 2	270.020
	CRR073314	Silver flowering 3	198.874
	CRR073315	Gold flowering 1	196.458
	CRR073316	Gold flowering 2	137.597
	CRR073317	Gold flowering 3	178.658
	CRR073318	Tawny withering 1	258.990
	CRR073319	Tawny withering 2	283.925
	CRR073320	Tawny withering 3	332.822