Gene detail

Detail information of GWHGAAZE019733

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010659006.1	2.17367E-36	PREDICTED: 3-hydroxyisobutyryl-CoA hydrolase 1-like isoform X3 [Vitis vinifera]
Swissprot	tr\|Q1PEY5\|HIBC2_ARATH	2E-30	Probable 3-hydroxyisobutyryl-CoA hydrolase 2
trEMBL	tr\|F6HIV7\|F6HIV7_VITVI	2E-35	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB52182.1}
TAIR10	AT2G30650.1	2E-26	ATP-dependent caseinolytic (Clp) protease/crotonase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	59948066	59950236	+
GWHAAZE00000005	mRNA	59948066	59950236	+
GWHAAZE00000005	exon	59948066	59948141	+
GWHAAZE00000005	exon	59949072	59949157	+
GWHAAZE00000005	exon	59949717	59949847	+
GWHAAZE00000005	exon	59950125	59950236	+
GWHAAZE00000005	CDS	59948066	59948141	+
GWHAAZE00000005	CDS	59949072	59949157	+
GWHAAZE00000005	CDS	59949717	59949847	+
GWHAAZE00000005	CDS	59950125	59950236	+

Transcript Sequence
>GWHTAAZE019755 ATGCCAAAAGTATCAATTGGACTACTTCCAGATGTTAGGGCCTCTCATTTTTTATCAAGGCTCCCTTGTTTCCTTGGAGAATATTTGGGGTTGACTGGTGCAAGATTAGCTGGGAAAGCGATGCTGACATGTGGTCTCGCAACGCATTTCGTCCTTTCAAAGGGATCTTGCTTCCTGGAAAATGCACTCGATGTCGCGGCTTCATCCAATGTCTTCAATATATCAACTATATTAGCAATTGTCAAAAAATACTCGCAAAAAGGAGTCTTAACACAAGATAACATTCCTTCAAGATTGGAGACTATTAACAAATGCTTTTCGGGAGAAACTGATGAAGAAATACTATCATCATTGGTATGTTTTTATTTATCAACAAAAGACTACAAAATTTGTAGTCCGGAATAA

Network for GWHGAAZE019733

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16113.6	ECH_2	1	119	9.50E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05605	HIBCH	Metabolic pathways	map01100
		Carbon metabolism	map01200
		Propanoate metabolism	map00640
		Valine, leucine and isoleucine degradation	map00280
		beta-Alanine metabolism	map00410

Gene Ontology

GO term	Ontology	Name
GO:0003860	molecular_function	3-hydroxyisobutyryl-CoA hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.164
	SRR3591711	White flower	0.157
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.367
	SRR8316904	Silver flowering stage	0.480
	SRR8316905	Silver flowering stage	0.135
	SRR8316906	Gold flowering stage	0.134
	SRR8316907	Gold flowering stage	0.584
	SRR8316908	Gold flowering stage	0.139
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.211
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.057
	CNS0095613	Golden flower (tetraploid) 1	0.143
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.772
	CRR073307	Third green 2	0.917
	CRR073308	Third green 3	0.318
	CRR073309	Second white 1	0.570
	CRR073310	Second white 2	1.491
	CRR073311	Second white 3	0.596
	CRR073312	Silver flowering 1	0.255
	CRR073313	Silver flowering 2	0.330
	CRR073314	Silver flowering 3	0.530
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000