Gene detail

Detail information of GWHGAAZE019614

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGZ15315.1	1.12771E-31	mevalonate kinase [Platycodon grandiflorus]
Swissprot	tr\|P46086\|KIME_ARATH	1E-23	Mevalonate kinase
trEMBL	tr\|V9PEX2\|V9PEX2_9ASTR	4E-32	Mevalonate kinase {ECO:0000313\|EMBL:AGZ15315.1}
TAIR10	AT5G27450.3	2E-14	mevalonate kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	54929499	54931669	-
GWHAAZE00000005	mRNA	54929499	54931669	-
GWHAAZE00000005	exon	54931438	54931669	-
GWHAAZE00000005	exon	54929499	54929673	-
GWHAAZE00000005	five_prime_UTR	54931569	54931669	-
GWHAAZE00000005	CDS	54931438	54931568	-
GWHAAZE00000005	CDS	54929499	54929673	-

Transcript Sequence
>GWHTAAZE019636 GTCGGAAACTATTGATTGTGGACGAGAATTCAAAGAATTGGAGACTGTTAACCTACACATTTTTGCTTTGTTGGAGAGATAGTTAAGATCAGTGAGTGAATATGTGGGTTAAAGCGAGAGCTCCTGGTAAGAATAAGATAATACTCGCCGGCGAACACGCCGTCGTTCAGGGATCTGCGGCGGTGGCTGCCTCCATTGATCTCCACCCCTACATTTCTCTCTCCTCCTTCGGGATAAAAGAGGCACTTCCTGAATTGGGTGGTTGTGCTGCTTTATCACCCAGATCTTGCTCTTCGGATACCATTAAGTCAATTGCAGGTCTAGTTGAAGTGCAGAATATTCCAGAGGCAAAAGTCGGACTTGCTGCTGGAGTTAGAGCTTTCCTCTTGCTATACACGTCTATTCAA

Network for GWHGAAZE019614

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00869	E2.7.1.36, MVK, mvaK1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Terpenoid backbone biosynthesis	map00900
		Peroxisome	map04146

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.186
	SRR3591706	second leaf	0.085
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.449
	SRR3591710	White floral bud	0.361
	SRR3591711	White flower	0.222
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.196
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.344
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.374
	SRR8316901	Third green stage	0.307
	SRR8316898	Complete white stage	0.114
	SRR8316899	Complete white stage	0.123
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.153
	SRR8316908	Gold flowering stage	0.133
SRP132670	SRR6706286	Control	0.063
	SRR6706287	Light intensity 50%	0.014
	SRR6706288	Light intensity 20%	0.081
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.246
	CNS0095593	Slightly white alabastrum(diploid) 2	0.281
	CNS0095594	Slightly white alabastrum(diploid) 3	0.294
	CNS0095595	Whole white alabastrum(diploid) 2	1.103
	CNS0095596	Whole white alabastrum(diploid) 3	0.795
	CNS0095597	Whole white alabastrum(diploid) 4	0.777
	CNS0095598	Silvery flower (diploied) 1	0.347
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.229
	CNS0095602	Golden flower (diploid) 2	0.193
	CNS0095603	Golden flower (diploid) 3	0.177
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.087
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.348
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.069
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.009
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.165
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.242
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.156
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.055
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.178
	CRR073298	Stem 2	0.048
	CRR073299	Stem 3	0.123
	CRR073300	Leaf 1	0.377
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.078
	CRR073305	Juvenile bud 3	0.117
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000