Gene detail

Detail information of GWHGAAZE019404

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AER38244.1	4.00719E-91	PME5 [Gossypium barbadense]
Swissprot	tr\|O04887\|PME2_CITSI	6E-86	Pectinesterase 2 (Precursor)
trEMBL	tr\|G9BHJ2\|G9BHJ2_GOSBA	1E-91	PME5 {ECO:0000313\|EMBL:AER38244.1}
TAIR10	AT2G45220.1	8E-56	Plant invertase/pectin methylesterase inhibitor superfamily

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	41235746	41237296	-
GWHAAZE00000005	mRNA	41235746	41237296	-
GWHAAZE00000005	exon	41237083	41237296	-
GWHAAZE00000005	exon	41235746	41236005	-
GWHAAZE00000005	CDS	41237083	41237296	-
GWHAAZE00000005	CDS	41235746	41236005	-

Transcript Sequence
>GWHTAAZE019426 AAGACAGTGGGGGAGGCGGTGGCAGCGGTTGGGAAGAGGGCGGGGAGTGGGAGGTATGTGATATATATTAAGGCAGGGACTTACCGGGAGAATGTGGAGGTGGGTTTAAAGTTGACGAATATTATGTTTTTGGGTGATGGTATTGGGAGGACTATTATAACCGGTAGCAAAAGTGTTGGTGGTGGCACCACCACCTTCAAATCGGCCACCGTTGCTGTCGTGGGAGACGGATTCATAGCCCGGGGCATAACATTCCGCAACACCGCGGGCCCACAGAACCACCAGGCCGTGGCCCTCCGGTCCGGCTCCGACCTCTCGGTATTTTACCAATGTTCCTTCGAAGGTTATCAAGACACTCTTTACGTTCACTCAGACCGCCAGTTTTATAAAAACTGTGATATTTACGGTACAGTCGACTTCATTTTTGGCAACGCTGCCGTAGTTTTCCAAAATTGCAATATTTACCCCGCATAA

Network for GWHGAAZE019404

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01095.20	Pectinesterase	1	155	1.70E-74

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01051	E3.1.1.11	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0042545	biological_process	cell wall modification
GO:0030599	molecular_function	pectinesterase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.034
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.334
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	49.870
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.075
	SRR8316903	Complete white stage	0.108
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.193
	SRR8316906	Gold flowering stage	1.431
	SRR8316907	Gold flowering stage	6.977
	SRR8316908	Gold flowering stage	3.261
SRP132670	SRR6706286	Control	0.008
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.081
	CNS0095598	Silvery flower (diploied) 1	0.025
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	27.293
	CNS0095603	Golden flower (diploid) 3	30.861
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	4.430
	CNS0095611	Silvery flower (tetraploid) 2	11.452
	CNS0095612	Silvery flower (tetraploid) 3	4.175
	CNS0095613	Golden flower (tetraploid) 1	16.351
	CNS0095614	Golden flower (tetraploid) 2	11.115
	CNS0095615	Golden flower (tetraploid) 3	17.450
CRA001975	CRR073297	Stem 1	0.050
	CRR073298	Stem 2	0.191
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.094
	CRR073301	Leaf 2	0.027
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.351
	CRR073304	Juvenile bud 2	0.035
	CRR073305	Juvenile bud 3	0.141
	CRR073306	Third green 1	0.076
	CRR073307	Third green 2	0.196
	CRR073308	Third green 3	0.159
	CRR073309	Second white 1	6.069
	CRR073310	Second white 2	7.026
	CRR073311	Second white 3	17.343
	CRR073312	Silver flowering 1	318.905
	CRR073313	Silver flowering 2	531.220
	CRR073314	Silver flowering 3	568.850
	CRR073315	Gold flowering 1	0.127
	CRR073316	Gold flowering 2	0.313
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.153
	CRR073319	Tawny withering 2	0.230
	CRR073320	Tawny withering 3	0.111