Gene detail

Detail information of GWHGAAZE017912

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010663172.1	4.01877E-13	PREDICTED: carbonic anhydrase 2-like [Vitis vinifera]
Swissprot	tr\|P27141\|CAHC_TOBAC	2E-11	Carbonic anhydrase, chloroplastic (Precursor)
trEMBL	tr\|D7SHR6\|D7SHR6_VITVI	1E-13	Carbonic anhydrase {ECO:0000256\|RuleBase:RU003956}
TAIR10	AT5G14740.2	0.0000005	carbonic anhydrase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	12409551	12410190	-
GWHAAZE00000005	mRNA	12409551	12410190	-
GWHAAZE00000005	exon	12409551	12409632	-
GWHAAZE00000005	exon	12409790	12409915	-
GWHAAZE00000005	exon	12410138	12410190	-
GWHAAZE00000005	CDS	12410138	12410190	-
GWHAAZE00000005	CDS	12409790	12409915	-
GWHAAZE00000005	CDS	12409551	12409632	-

Transcript Sequence
>GWHTAAZE017932 ATGGCTGAGCACTCAGTTGAGATTGCGGCTTCAAGGCTGAAGAACCTACTAAGGGAGCGAAAAGAGGAGGATGAATTAGAAGATGATCAGAGCAAATTAGATACAACAACACCAGCTCCATTTGATCCAGTTGAAAGGATTAAGAAAGGATTTTTCTACTTCAAGACACACGAATTCGACAAGTATCCAGCGTATTACCATCAACTTGCACAAGCCCAGAGCCCCAAGGTGACGCCCCTTTCTGGAATTCAATGTTACTGA

Network for GWHGAAZE017912

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01673	cynT, can	Metabolic pathways	map01100
K01673	cynT, can	Nitrogen metabolism	map00910

Gene Ontology

GO term	Ontology	Name
GO:0004089	molecular_function	carbonate dehydratase activity
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.394
	SRR3591710	White floral bud	8.755
	SRR3591711	White flower	34.646
	SRR3591712	Green floral bud	1.407
	SRR3591713	Yellow flower	16.097
SRP173429	SRR8316895	Juvenile bud stage	0.293
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.186
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.751
	SRR8316899	Complete white stage	0.211
	SRR8316903	Complete white stage	1.753
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	3.945
	SRR8316908	Gold flowering stage	1.699
SRP132670	SRR6706286	Control	1.198
	SRR6706287	Light intensity 50%	0.849
	SRR6706288	Light intensity 20%	0.125
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.987
	CNS0095593	Slightly white alabastrum(diploid) 2	0.085
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.426
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	5.217
	CNS0095599	Silvery flower (diploied) 2	0.249
	CNS0095600	Silvery flower (diploied) 3	0.281
	CNS0095601	Golden flower (diploid) 1	1.397
	CNS0095602	Golden flower (diploid) 2	2.469
	CNS0095603	Golden flower (diploid) 3	3.318
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.549
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.217
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.293
	CNS0095610	Silvery flower (tetraploid) 1	7.231
	CNS0095611	Silvery flower (tetraploid) 2	5.248
	CNS0095612	Silvery flower (tetraploid) 3	6.209
	CNS0095613	Golden flower (tetraploid) 1	5.555
	CNS0095614	Golden flower (tetraploid) 2	39.013
	CNS0095615	Golden flower (tetraploid) 3	7.362
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.174
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.053
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.177
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.371
	CRR073320	Tawny withering 3	1.887