Gene detail

Detail information of GWHGAAZE017911

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010663172.1	2.83232E-84	PREDICTED: carbonic anhydrase 2-like [Vitis vinifera]
Swissprot	tr\|P17067\|CAHC_PEA	2E-77	Carbonic anhydrase, 25 kDa isoform (Precursor)
trEMBL	tr\|D7SHR6\|D7SHR6_VITVI	1E-84	Carbonic anhydrase {ECO:0000256\|RuleBase:RU003956}
TAIR10	AT3G01500.3	4E-54	carbonic anhydrase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	12408499	12409490	-
GWHAAZE00000005	mRNA	12408499	12409490	-
GWHAAZE00000005	exon	12408499	12408660	-
GWHAAZE00000005	exon	12408771	12408876	-
GWHAAZE00000005	exon	12408978	12409063	-
GWHAAZE00000005	exon	12409158	12409211	-
GWHAAZE00000005	exon	12409326	12409490	-
GWHAAZE00000005	CDS	12409326	12409490	-
GWHAAZE00000005	CDS	12409158	12409211	-
GWHAAZE00000005	CDS	12408978	12409063	-
GWHAAZE00000005	CDS	12408771	12408876	-
GWHAAZE00000005	CDS	12408499	12408660	-

Transcript Sequence
>GWHTAAZE017931 ATGATTCGATTGAGTTTTAAATTTGTGACAAAAATGGGATGGGTGCAGTTTCTGGTGTTTGCCTGCTCGGATTCTCGAGTTTGTCCCTCTAATATCCTAAAGTTTAAACCAGGGGAAGCTTTCATGACTCGAAATATAGCCAATATGGTCCCGGAATTTAACCAGCTTAGATACTCTGGAACTGGTGCAGTCATCGAATATGCAGTCGTTGCTCTTGAGGTTGAAGTCATACTGGTGATTGGCCACAGTCGATGTGGTGGAATTAGGGCACTTATGACGCACTCTGACAATGGAACAAATTCTTCTGACTTCATCGAGGACTGGGTTAAAATCGGTTTACCCGCTAAGTTGAAGGTGAAGTCTGAGTTCGGTCATTTACCAGAAGAAAAACAAATAGAGAAATGTGAAAGGGAGGCAGTTAATGCGTCGCTGGTGAATCTACTGACATACCCATACGTGAGAGCTGGGTTGGCAAACAAAAAGCTAGAGTTGATGGGTGGATACTATGATTTTGTCAATGGAAAATTTGAAATGTGGGGAATGGATTTTGTCAACAAAGACCTCTGCATCTGA

Network for GWHGAAZE017911

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00484.20	Pro_CA	18	175	4.10E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01673	cynT, can	Metabolic pathways	map01100
K01673	cynT, can	Nitrogen metabolism	map00910

Gene Ontology

GO term	Ontology	Name
GO:0015976	biological_process	carbon utilization
GO:0004089	molecular_function	carbonate dehydratase activity
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	9.814
	SRR3591711	White flower	38.410
	SRR3591712	Green floral bud	2.039
	SRR3591713	Yellow flower	28.937
SRP173429	SRR8316895	Juvenile bud stage	0.113
	SRR8316896	Juvenile bud stage	0.179
	SRR8316897	Juvenile bud stage	0.117
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.126
	SRR8316901	Third green stage	0.043
	SRR8316898	Complete white stage	0.861
	SRR8316899	Complete white stage	0.143
	SRR8316903	Complete white stage	1.723
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.122
	SRR8316907	Gold flowering stage	2.529
	SRR8316908	Gold flowering stage	1.679
SRP132670	SRR6706286	Control	1.051
	SRR6706287	Light intensity 50%	1.483
	SRR6706288	Light intensity 20%	0.120
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.018
	CNS0095593	Slightly white alabastrum(diploid) 2	0.252
	CNS0095594	Slightly white alabastrum(diploid) 3	0.128
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.090
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.779
	CNS0095599	Silvery flower (diploied) 2	0.777
	CNS0095600	Silvery flower (diploied) 3	0.722
	CNS0095601	Golden flower (diploid) 1	1.094
	CNS0095602	Golden flower (diploid) 2	2.021
	CNS0095603	Golden flower (diploid) 3	1.567
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.039
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.182
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.211
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.236
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.034
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.070
	CNS0095610	Silvery flower (tetraploid) 1	5.837
	CNS0095611	Silvery flower (tetraploid) 2	6.031
	CNS0095612	Silvery flower (tetraploid) 3	6.442
	CNS0095613	Golden flower (tetraploid) 1	5.871
	CNS0095614	Golden flower (tetraploid) 2	35.130
	CNS0095615	Golden flower (tetraploid) 3	7.574
CRA001975	CRR073297	Stem 1	0.310
	CRR073298	Stem 2	0.005
	CRR073299	Stem 3	0.146
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.131
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.261
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.046
	CRR073316	Gold flowering 2	0.287
	CRR073317	Gold flowering 3	0.304
	CRR073318	Tawny withering 1	0.197
	CRR073319	Tawny withering 2	0.135
	CRR073320	Tawny withering 3	1.397