Gene detail

Detail information of GWHGAAZE017774

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002284686.1	2.86064E-72	PREDICTED: dCTP pyrophosphatase 1 [Vitis vinifera]
trEMBL	tr\|F6GT53\|F6GT53_VITVI	1E-72	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43062.1}
TAIR10	AT3G25400.1	1E-29	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	10660343	10661285	-
GWHAAZE00000005	mRNA	10660343	10661285	-
GWHAAZE00000005	exon	10660343	10660588	-
GWHAAZE00000005	exon	10661145	10661285	-
GWHAAZE00000005	CDS	10661145	10661285	-
GWHAAZE00000005	CDS	10660343	10660588	-

Transcript Sequence
>GWHTAAZE017794 ATGGAGAATTGCCATCATGATGAGTACAGTAGGAGAGCTAAAGATGTTTCTCTTTATGAACTGAGAGATAGGCTGGCTGAGTTTGCTAGAGTCAGGGGTTGGGATCAGTATCATAGTCCAAGAAATCTCCTTTTGGCTCTGGTTGGAGAAGTAGGAGAGCTATCAGAAATATTCCAATGGAAAGGAGAAGTAGAAAGAGGATTACCAAATTGGTCAGCTGAAGATAAAGAGCACCTAGAGGAGGAACTATCTGATGTATTACTCTATCTGGTTCAGCTTTCCGATGTTTGTGGCCTTGATCTTGGCCAAGCTGCTCTCTCTAAAATTGTCAAAAATGCCCACAAATATCCAGTTGTTACTTCATCCAGTAGCTCTACCTACAACTAG

Network for GWHGAAZE017774

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03819.18	MazG	39	119	1.40E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16904	DCTPP1	Metabolic pathways	map01100
K16904	DCTPP1	Pyrimidine metabolism	map00240

Gene Ontology

GO term	Ontology	Name
GO:0009143	biological_process	nucleoside triphosphate catabolic process
GO:0047429	molecular_function	nucleoside-triphosphate diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.691
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.315
	SRR3591708	Shoot apex	0.874
	SRR3591709	Stem	15.239
	SRR3591710	White floral bud	1.885
	SRR3591711	White flower	0.193
	SRR3591712	Green floral bud	3.769
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.092
	SRR8316896	Juvenile bud stage	2.106
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	2.455
	SRR8316900	Third green stage	9.719
	SRR8316901	Third green stage	8.631
	SRR8316898	Complete white stage	2.321
	SRR8316899	Complete white stage	15.535
	SRR8316903	Complete white stage	1.188
	SRR8316902	Silver flowering stage	0.369
	SRR8316904	Silver flowering stage	1.652
	SRR8316905	Silver flowering stage	0.535
	SRR8316906	Gold flowering stage	1.329
	SRR8316907	Gold flowering stage	0.380
	SRR8316908	Gold flowering stage	0.316
SRP132670	SRR6706286	Control	4.030
	SRR6706287	Light intensity 50%	5.031
	SRR6706288	Light intensity 20%	3.789
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.857
	CNS0095593	Slightly white alabastrum(diploid) 2	9.966
	CNS0095594	Slightly white alabastrum(diploid) 3	3.577
	CNS0095595	Whole white alabastrum(diploid) 2	8.585
	CNS0095596	Whole white alabastrum(diploid) 3	9.392
	CNS0095597	Whole white alabastrum(diploid) 4	9.387
	CNS0095598	Silvery flower (diploied) 1	1.903
	CNS0095599	Silvery flower (diploied) 2	2.232
	CNS0095600	Silvery flower (diploied) 3	2.221
	CNS0095601	Golden flower (diploid) 1	0.154
	CNS0095602	Golden flower (diploid) 2	4.126
	CNS0095603	Golden flower (diploid) 3	2.009
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.745
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.106
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.665
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.898
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.884
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.777
	CNS0095610	Silvery flower (tetraploid) 1	2.615
	CNS0095611	Silvery flower (tetraploid) 2	4.142
	CNS0095612	Silvery flower (tetraploid) 3	6.969
	CNS0095613	Golden flower (tetraploid) 1	2.902
	CNS0095614	Golden flower (tetraploid) 2	4.241
	CNS0095615	Golden flower (tetraploid) 3	0.772
CRA001975	CRR073297	Stem 1	2.369
	CRR073298	Stem 2	0.938
	CRR073299	Stem 3	0.808
	CRR073300	Leaf 1	4.212
	CRR073301	Leaf 2	6.708
	CRR073302	Leaf 3	4.699
	CRR073303	Juvenile bud 1	5.392
	CRR073304	Juvenile bud 2	3.232
	CRR073305	Juvenile bud 3	8.796
	CRR073306	Third green 1	0.459
	CRR073307	Third green 2	1.265
	CRR073308	Third green 3	1.552
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.071
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.141
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.209
	CRR073316	Gold flowering 2	0.193
	CRR073317	Gold flowering 3	0.097
	CRR073318	Tawny withering 1	5.674
	CRR073319	Tawny withering 2	4.291
	CRR073320	Tawny withering 3	5.706