Gene detail

Detail information of GWHGAAZE017759

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU31591.1	1.44201E-62	hypothetical protein MIMGU_mgv1a011799mg [Erythranthe guttata]
Swissprot	tr\|Q9LLC1\|BCCP2_ARATH	9E-52	Biotin carboxyl carrier protein of acetyl-CoA carboxylase 2, chloroplastic (Precursor)
trEMBL	tr\|A0A022QUL6\|A0A022QUL6_ERYGU	5E-63	Uncharacterized protein {ECO:0000313\|EMBL:EYU31591.1}
TAIR10	AT5G16390.1	3E-31	chloroplastic acetylcoenzyme A carboxylase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	10492498	10493961	-
GWHAAZE00000005	mRNA	10492498	10493961	-
GWHAAZE00000005	exon	10493635	10493961	-
GWHAAZE00000005	exon	10493309	10493419	-
GWHAAZE00000005	exon	10492621	10492686	-
GWHAAZE00000005	exon	10492498	10492521	-
GWHAAZE00000005	CDS	10493635	10493961	-
GWHAAZE00000005	CDS	10493309	10493419	-
GWHAAZE00000005	CDS	10492621	10492686	-
GWHAAZE00000005	CDS	10492498	10492521	-

Transcript Sequence
>GWHTAAZE017779 ATGATTTTCTGTTGCAGGCTTGTGGATTCGAGAGACATCTCGGAGCTGCAGCTAAAACAACTGGATTGTGAACTCCTTATAAGGAAAAAGGAAGCCTTGCCGCATCCACCTGTTGCTGCCCCTTCTTTTGTGATGCAACACCTTCCTCCACCACCTCCAGCGGCGGTTCCCACTCTTGCTCCTGCTGCTGCAGGTCCAGTTCCCTCTCCTTCGGCACCGGCTCCTACTGCCCCTGCAAAGCCAAAGTCGACTCATCCCCCACTAAAATGCCCCATGGCTGGAACTTTCTATCGCTGCCCTGCACCTGGAGCCCCGCCTTTTGTGAAGGTTGGAGACAAGGTCCAGAAAGGTCAGGTGATCTGCATCATTGAGGCCATGAAGCTGATGAATGAAATTGAAGTAAGTCTCTTTTTTTTTTCCTTATCATCATTTCCTAATGCTGATCAGTCTGGAACTCTAGTTGAGATACTTGTAGATGACGCCAAGCCAGTTAGTGTCGACACGCCGCTATTTGTCATTGAGCCATGA

Network for GWHGAAZE017759

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00364.23	Biotin_lipoyl	88	134	4.10E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02160	accB, bccP	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Fatty acid metabolism	map01212
		Pyruvate metabolism	map00620
		Propanoate metabolism	map00640
		Carbon fixation pathways in prokaryotes	map00720
		Fatty acid biosynthesis	map00061

Gene Ontology

GO term	Ontology	Name
GO:0006633	biological_process	fatty acid biosynthetic process
GO:0009317	cellular_component	acetyl-CoA carboxylase complex
GO:0003989	molecular_function	acetyl-CoA carboxylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	28.369
	SRR3591706	second leaf	48.002
	SRR3591707	mature leaf	13.915
	SRR3591708	Shoot apex	43.289
	SRR3591709	Stem	8.502
	SRR3591710	White floral bud	38.354
	SRR3591711	White flower	22.076
	SRR3591712	Green floral bud	45.902
	SRR3591713	Yellow flower	16.392
SRP173429	SRR8316895	Juvenile bud stage	21.955
	SRR8316896	Juvenile bud stage	36.632
	SRR8316897	Juvenile bud stage	14.998
	SRR8316894	Third green stage	11.076
	SRR8316900	Third green stage	45.269
	SRR8316901	Third green stage	48.420
	SRR8316898	Complete white stage	13.784
	SRR8316899	Complete white stage	22.824
	SRR8316903	Complete white stage	22.986
	SRR8316902	Silver flowering stage	15.062
	SRR8316904	Silver flowering stage	17.317
	SRR8316905	Silver flowering stage	6.557
	SRR8316906	Gold flowering stage	23.587
	SRR8316907	Gold flowering stage	25.387
	SRR8316908	Gold flowering stage	23.463
SRP132670	SRR6706286	Control	33.981
	SRR6706287	Light intensity 50%	30.015
	SRR6706288	Light intensity 20%	30.579
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.443
	CNS0095593	Slightly white alabastrum(diploid) 2	25.924
	CNS0095594	Slightly white alabastrum(diploid) 3	31.695
	CNS0095595	Whole white alabastrum(diploid) 2	31.558
	CNS0095596	Whole white alabastrum(diploid) 3	40.040
	CNS0095597	Whole white alabastrum(diploid) 4	22.003
	CNS0095598	Silvery flower (diploied) 1	10.521
	CNS0095599	Silvery flower (diploied) 2	12.561
	CNS0095600	Silvery flower (diploied) 3	18.675
	CNS0095601	Golden flower (diploid) 1	10.619
	CNS0095602	Golden flower (diploid) 2	12.353
	CNS0095603	Golden flower (diploid) 3	9.610
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.471
	CNS0095605	Slightly white alabastrum(tetraploid) 2	46.412
	CNS0095606	Slightly white alabastrum(tetraploid) 3	45.870
	CNS0095607	Whole white alabastrum(tetraploid) 1	45.570
	CNS0095608	Whole white alabastrum(tetraploid) 2	47.539
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.268
	CNS0095610	Silvery flower (tetraploid) 1	24.611
	CNS0095611	Silvery flower (tetraploid) 2	21.713
	CNS0095612	Silvery flower (tetraploid) 3	54.866
	CNS0095613	Golden flower (tetraploid) 1	14.174
	CNS0095614	Golden flower (tetraploid) 2	18.334
	CNS0095615	Golden flower (tetraploid) 3	10.630
CRA001975	CRR073297	Stem 1	40.864
	CRR073298	Stem 2	37.496
	CRR073299	Stem 3	38.616
	CRR073300	Leaf 1	55.708
	CRR073301	Leaf 2	50.013
	CRR073302	Leaf 3	45.925
	CRR073303	Juvenile bud 1	47.297
	CRR073304	Juvenile bud 2	46.118
	CRR073305	Juvenile bud 3	45.879
	CRR073306	Third green 1	66.219
	CRR073307	Third green 2	54.070
	CRR073308	Third green 3	41.005
	CRR073309	Second white 1	30.478
	CRR073310	Second white 2	16.434
	CRR073311	Second white 3	13.377
	CRR073312	Silver flowering 1	12.188
	CRR073313	Silver flowering 2	17.094
	CRR073314	Silver flowering 3	10.309
	CRR073315	Gold flowering 1	33.059
	CRR073316	Gold flowering 2	38.343
	CRR073317	Gold flowering 3	36.241
	CRR073318	Tawny withering 1	24.586
	CRR073319	Tawny withering 2	25.968
	CRR073320	Tawny withering 3	32.113