Gene detail

Detail information of GWHGAAZE017572

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009764802.1	2.16887E-94	PREDICTED: phosphatidyl-N-methylethanolamine N-methyltransferase [Nicotiana sylvestris]
Swissprot	tr\|Q9SAH5\|PLMT_ARATH	4E-88	Phosphatidyl-N-methylethanolamine N-methyltransferase
trEMBL	tr\|A0A067DR19\|A0A067DR19_CITSI	2E-94	Uncharacterized protein {ECO:0000313\|EMBL:KDO44015.1}
TAIR10	AT1G80860.2	8E-53	phospholipid N-methyltransferase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	8097248	8099378	-
GWHAAZE00000005	mRNA	8097248	8099378	-
GWHAAZE00000005	exon	8097248	8097497	-
GWHAAZE00000005	exon	8099134	8099378	-
GWHAAZE00000005	CDS	8099134	8099378	-
GWHAAZE00000005	CDS	8097248	8097497	-

Transcript Sequence
>GWHTAAZE017592 ATGGCAGTAGCAGCATGTATAGGGGTTTTATTGCCCTTTCCGTTTTACTACTGGGTGTGGAATTACCCGCAGACATGGGTGGATCTGTGCGGCAAAGGACGAGACCCTTCTAAATTCATGGCTTCGGTGTCTCATTTCTTGAAGCTCCTTCAGTTCCTCTCTCTCTTATCTGTTTCTTCGCTTTCTTGGCCGCCTCCTTTCTACTTTTGGCCCCTCTTTCTCTTCGGCCAGTTCCTCAATTTCAGGGTATATCAGTTGCTTGGTGAATCAGGGACTTACTATGGCGTACGCTTTGGGAAGAACATCCCATGGATAACACAATTTCCATTTGGGGTGATAAGGGATCCTCAGTATGCTGGCAGTATTGTGAGCTTGCTTGCGTGTCTAGCATGGGTTCCCTTCCTATATATTCTCCTATGGATAATTGGCTACGTGTTCATCATACAAATAGAATCTAAAGAAGATCCAACTACTCGTGCCAAGCCACTATCTTGA

Network for GWHGAAZE017572

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04191.14	PEMT	71	157	9.90E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00550	PLMT	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glycerophospholipid metabolism	map00564

Gene Ontology

GO term	Ontology	Name
GO:0006656	biological_process	phosphatidylcholine biosynthetic process
GO:0008757	molecular_function	S-adenosylmethionine-dependent methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.865
	SRR3591706	second leaf	19.922
	SRR3591707	mature leaf	10.764
	SRR3591708	Shoot apex	35.019
	SRR3591709	Stem	26.750
	SRR3591710	White floral bud	15.573
	SRR3591711	White flower	12.491
	SRR3591712	Green floral bud	31.183
	SRR3591713	Yellow flower	6.915
SRP173429	SRR8316895	Juvenile bud stage	17.554
	SRR8316896	Juvenile bud stage	37.039
	SRR8316897	Juvenile bud stage	13.485
	SRR8316894	Third green stage	11.391
	SRR8316900	Third green stage	29.962
	SRR8316901	Third green stage	31.180
	SRR8316898	Complete white stage	3.321
	SRR8316899	Complete white stage	20.542
	SRR8316903	Complete white stage	6.793
	SRR8316902	Silver flowering stage	3.602
	SRR8316904	Silver flowering stage	4.539
	SRR8316905	Silver flowering stage	2.154
	SRR8316906	Gold flowering stage	9.446
	SRR8316907	Gold flowering stage	7.833
	SRR8316908	Gold flowering stage	4.449
SRP132670	SRR6706286	Control	16.051
	SRR6706287	Light intensity 50%	17.014
	SRR6706288	Light intensity 20%	18.860
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	52.419
	CNS0095593	Slightly white alabastrum(diploid) 2	38.977
	CNS0095594	Slightly white alabastrum(diploid) 3	68.994
	CNS0095595	Whole white alabastrum(diploid) 2	42.220
	CNS0095596	Whole white alabastrum(diploid) 3	49.884
	CNS0095597	Whole white alabastrum(diploid) 4	36.448
	CNS0095598	Silvery flower (diploied) 1	15.863
	CNS0095599	Silvery flower (diploied) 2	14.494
	CNS0095600	Silvery flower (diploied) 3	11.428
	CNS0095601	Golden flower (diploid) 1	13.785
	CNS0095602	Golden flower (diploid) 2	18.160
	CNS0095603	Golden flower (diploid) 3	15.231
	CNS0095604	Slightly white alabastrum(tetraploid) 1	57.778
	CNS0095605	Slightly white alabastrum(tetraploid) 2	63.400
	CNS0095606	Slightly white alabastrum(tetraploid) 3	21.485
	CNS0095607	Whole white alabastrum(tetraploid) 1	42.654
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.375
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.881
	CNS0095610	Silvery flower (tetraploid) 1	8.182
	CNS0095611	Silvery flower (tetraploid) 2	8.608
	CNS0095612	Silvery flower (tetraploid) 3	5.712
	CNS0095613	Golden flower (tetraploid) 1	4.815
	CNS0095614	Golden flower (tetraploid) 2	8.017
	CNS0095615	Golden flower (tetraploid) 3	8.695
CRA001975	CRR073297	Stem 1	24.164
	CRR073298	Stem 2	20.850
	CRR073299	Stem 3	26.304
	CRR073300	Leaf 1	21.195
	CRR073301	Leaf 2	21.262
	CRR073302	Leaf 3	23.699
	CRR073303	Juvenile bud 1	17.196
	CRR073304	Juvenile bud 2	14.808
	CRR073305	Juvenile bud 3	8.531
	CRR073306	Third green 1	1.854
	CRR073307	Third green 2	4.325
	CRR073308	Third green 3	3.729
	CRR073309	Second white 1	1.288
	CRR073310	Second white 2	1.411
	CRR073311	Second white 3	1.681
	CRR073312	Silver flowering 1	2.424
	CRR073313	Silver flowering 2	1.275
	CRR073314	Silver flowering 3	4.082
	CRR073315	Gold flowering 1	6.241
	CRR073316	Gold flowering 2	6.350
	CRR073317	Gold flowering 3	6.795
	CRR073318	Tawny withering 1	12.514
	CRR073319	Tawny withering 2	10.709
	CRR073320	Tawny withering 3	10.284