Gene detail

Detail information of GWHGAAZE017406

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009784626.1	1.82684E-56	PREDICTED: dynein light chain LC6, flagellar outer arm-like [Nicotiana sylvestris]
Swissprot	tr\|Q39580\|DYL1_CHLRE	2E-21	Dynein 8 kDa light chain, flagellar outer arm
trEMBL	tr\|A0A067KQK9\|A0A067KQK9_JATCU	8E-57	Uncharacterized protein {ECO:0000313\|EMBL:KDP37243.1}
TAIR10	AT1G52240.2	6E-33	RHO guanyl-nucleotide exchange factor 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	5845556	5845942	-
GWHAAZE00000005	mRNA	5845556	5845942	-
GWHAAZE00000005	exon	5845556	5845726	-
GWHAAZE00000005	exon	5845805	5845942	-
GWHAAZE00000005	CDS	5845805	5845942	-
GWHAAZE00000005	CDS	5845556	5845726	-

Transcript Sequence
>GWHTAAZE017426 ATGTTGGAAGGAAAAGCTTTGGTACAGGACACAGATATGCCTATGAAGATGCAGATTCAAGCCATGGCCTCTGCTTCTCAAGCTTTGGATCTCTATGATGTTATTGACTGCAAATCCATTGCTGCCCACATTAAAAAGGAATTTGACAAGAAATATGGGAATGGATGGCAATGCGCGGTGGGATCAAACTTCAGCTGTTTCTTCACTCATACAACAGGGACCTTCATTTATTTCACTCTCGAAAGATTAAACTTCCTCATCTTCAAAGGGGTTTCTTCTTCTTCTCCTTCTCCCTCATCCTCTCCATGA

Network for GWHGAAZE017406

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01221.19	Dynein_light	5	89	1.50E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10418	DYNLL	Vasopressin-regulated water reabsorption	map04962

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0030286	cellular_component	dynein complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	29.021
	SRR3591706	second leaf	21.367
	SRR3591707	mature leaf	31.001
	SRR3591708	Shoot apex	63.910
	SRR3591709	Stem	9.139
	SRR3591710	White floral bud	34.990
	SRR3591711	White flower	4.999
	SRR3591712	Green floral bud	23.463
	SRR3591713	Yellow flower	3.958
SRP173429	SRR8316895	Juvenile bud stage	3.759
	SRR8316896	Juvenile bud stage	6.038
	SRR8316897	Juvenile bud stage	5.668
	SRR8316894	Third green stage	2.445
	SRR8316900	Third green stage	8.045
	SRR8316901	Third green stage	3.696
	SRR8316898	Complete white stage	5.782
	SRR8316899	Complete white stage	4.503
	SRR8316903	Complete white stage	8.432
	SRR8316902	Silver flowering stage	2.075
	SRR8316904	Silver flowering stage	3.961
	SRR8316905	Silver flowering stage	1.598
	SRR8316906	Gold flowering stage	3.814
	SRR8316907	Gold flowering stage	4.456
	SRR8316908	Gold flowering stage	3.149
SRP132670	SRR6706286	Control	1.607
	SRR6706287	Light intensity 50%	2.297
	SRR6706288	Light intensity 20%	2.107
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.748
	CNS0095593	Slightly white alabastrum(diploid) 2	7.168
	CNS0095594	Slightly white alabastrum(diploid) 3	13.324
	CNS0095595	Whole white alabastrum(diploid) 2	17.948
	CNS0095596	Whole white alabastrum(diploid) 3	16.193
	CNS0095597	Whole white alabastrum(diploid) 4	23.162
	CNS0095598	Silvery flower (diploied) 1	8.641
	CNS0095599	Silvery flower (diploied) 2	10.655
	CNS0095600	Silvery flower (diploied) 3	2.934
	CNS0095601	Golden flower (diploid) 1	10.247
	CNS0095602	Golden flower (diploid) 2	8.396
	CNS0095603	Golden flower (diploid) 3	4.188
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.548
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.166
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.506
	CNS0095607	Whole white alabastrum(tetraploid) 1	32.262
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.217
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.500
	CNS0095610	Silvery flower (tetraploid) 1	2.926
	CNS0095611	Silvery flower (tetraploid) 2	5.266
	CNS0095612	Silvery flower (tetraploid) 3	13.571
	CNS0095613	Golden flower (tetraploid) 1	5.091
	CNS0095614	Golden flower (tetraploid) 2	5.747
	CNS0095615	Golden flower (tetraploid) 3	3.927
CRA001975	CRR073297	Stem 1	6.218
	CRR073298	Stem 2	5.273
	CRR073299	Stem 3	6.805
	CRR073300	Leaf 1	0.816
	CRR073301	Leaf 2	1.690
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	3.179
	CRR073304	Juvenile bud 2	6.743
	CRR073305	Juvenile bud 3	0.376
	CRR073306	Third green 1	3.578
	CRR073307	Third green 2	4.854
	CRR073308	Third green 3	2.098
	CRR073309	Second white 1	1.828
	CRR073310	Second white 2	2.941
	CRR073311	Second white 3	1.655
	CRR073312	Silver flowering 1	2.285
	CRR073313	Silver flowering 2	1.674
	CRR073314	Silver flowering 3	2.706
	CRR073315	Gold flowering 1	23.682
	CRR073316	Gold flowering 2	31.699
	CRR073317	Gold flowering 3	12.811
	CRR073318	Tawny withering 1	5.370
	CRR073319	Tawny withering 2	0.809
	CRR073320	Tawny withering 3	3.818