Gene detail

Detail information of GWHGAAZE016941

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009762461.1	2.97672E-21	PREDICTED: shikimate kinase, chloroplastic [Nicotiana sylvestris]
Swissprot	tr\|Q00497\|SK_SOLLC	1E-20	Shikimate kinase, chloroplastic (Precursor)
trEMBL	tr\|X5CTX7\|X5CTX7_TOBAC	1E-21	Shikimate kinase {ECO:0000313\|EMBL:AHW50680.1}
TAIR10	AT2G21940.3	2E-14	shikimate kinase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	86807706	86812063	+
GWHAAZE00000004	mRNA	86807706	86812063	+
GWHAAZE00000004	exon	86807706	86807770	+
GWHAAZE00000004	exon	86807998	86808052	+
GWHAAZE00000004	exon	86808134	86808206	+
GWHAAZE00000004	exon	86808651	86808738	+
GWHAAZE00000004	exon	86811746	86812063	+
GWHAAZE00000004	five_prime_UTR	86807706	86807770	+
GWHAAZE00000004	five_prime_UTR	86807998	86808052	+
GWHAAZE00000004	five_prime_UTR	86808134	86808135	+
GWHAAZE00000004	CDS	86808136	86808206	+
GWHAAZE00000004	CDS	86808651	86808738	+
GWHAAZE00000004	CDS	86811746	86812063	+

Transcript Sequence
>GWHTAAZE016961 AGCTTCAGCATTAATTGGAGTTTGAAAGCTTGCCTGCTTCAATTGAAGAAGCTCTAGTTTTAAAGAGTAAGTCAGAAGAAATTGAACCATATTTAGATGACCGGTGTATATATCTTGTTGGAATGATGGGCTCAGGTAAAACAACTATTGGCAGGATTTTGGCAGAAGTACTTGGTTATTCATTTTTGGACAGTGACAAGTTGATAGAGCAGGATGTTGGGGGGACTGTTGTATCTGACATCTTTAAGCTACATGGTGAGAGCTTCTTCAGAAATACTGAAAAGTGTAATTTTCTTGGATACGGCGGCGATGATTTCGGTTATAGATTGTGGGATGACAAGAACCGAAAAATCATCAGAAGCAGATATATAGTATTCAATAATAAGGTGATGTACAAGGATAGAGACGCAACAAATTCAAGTAATTCAGTGCAGCATAATCCTATGTATGCTAATATTATTGATATTCCAAAAAGCAGTCAGACAGAACAGACAGAAGAAAGTTCTCAGACAGATGAAGCAATACAACAGGATAATACGCAACAGACGGAGGCAGAAGAACCTTCAACTCATACTCCTGTAATTAGGCGGTCTTCCTAG

Network for GWHGAAZE016941

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01202.23	SKI	2	54	2.70E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00891	aroK, aroL	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Phenylalanine, tyrosine and tryptophan biosynthesis	map00400

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.019
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.323
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.080
	SRR3591710	White floral bud	0.092
	SRR3591711	White flower	0.101
	SRR3591712	Green floral bud	0.735
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.869
	SRR8316896	Juvenile bud stage	0.162
	SRR8316897	Juvenile bud stage	0.176
	SRR8316894	Third green stage	0.113
	SRR8316900	Third green stage	0.387
	SRR8316901	Third green stage	0.222
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.171
	SRR8316902	Silver flowering stage	0.223
	SRR8316904	Silver flowering stage	0.110
	SRR8316905	Silver flowering stage	0.325
	SRR8316906	Gold flowering stage	0.262
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.134
SRP132670	SRR6706286	Control	0.021
	SRR6706287	Light intensity 50%	0.007
	SRR6706288	Light intensity 20%	0.012
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.449
	CNS0095593	Slightly white alabastrum(diploid) 2	0.074
	CNS0095594	Slightly white alabastrum(diploid) 3	0.238
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.107
	CNS0095597	Whole white alabastrum(diploid) 4	0.076
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.372
	CNS0095601	Golden flower (diploid) 1	0.072
	CNS0095602	Golden flower (diploid) 2	0.175
	CNS0095603	Golden flower (diploid) 3	0.069
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.550
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.073
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.467
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.602
	CNS0095610	Silvery flower (tetraploid) 1	0.625
	CNS0095611	Silvery flower (tetraploid) 2	0.021
	CNS0095612	Silvery flower (tetraploid) 3	0.660
	CNS0095613	Golden flower (tetraploid) 1	0.043
	CNS0095614	Golden flower (tetraploid) 2	0.234
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.349
	CRR073298	Stem 2	0.346
	CRR073299	Stem 3	0.009
	CRR073300	Leaf 1	0.131
	CRR073301	Leaf 2	0.036
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.115
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.173
	CRR073306	Third green 1	0.032
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.121
	CRR073309	Second white 1	0.562
	CRR073310	Second white 2	0.014
	CRR073311	Second white 3	0.342
	CRR073312	Silver flowering 1	0.805
	CRR073313	Silver flowering 2	0.062
	CRR073314	Silver flowering 3	0.394
	CRR073315	Gold flowering 1	0.100
	CRR073316	Gold flowering 2	0.024
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.009
	CRR073319	Tawny withering 2	0.105
	CRR073320	Tawny withering 3	0.123