Gene detail

Detail information of GWHGAAZE016016

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP07073.1	8.8454E-125	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068UHF6\|A0A068UHF6_COFCA	3E-125	Coffea canephora DH200=94 genomic scaffold, scaffold_24 {ECO:0000313\|EMBL:CDP07073.1}
TAIR10	AT3G45100.2	1E-93	UDP-Glycosyltransferase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	66525368	66526356	+
GWHAAZE00000004	mRNA	66525368	66526356	+
GWHAAZE00000004	exon	66525368	66525487	+
GWHAAZE00000004	exon	66525772	66526356	+
GWHAAZE00000004	CDS	66525368	66525487	+
GWHAAZE00000004	CDS	66525772	66526242	+
GWHAAZE00000004	three_prime_UTR	66526243	66526356	+

Transcript Sequence
>GWHTAAZE016036 ATGACGGAGCAGGGAAGAAATAGGATTTTGATGGTGTCCGATTTTTTTTATCCTAACTTTGGCGGCGTCAAGAATCACATTTGTTATCTATCGCAATGCTTGCTTAAGCTTGGCCATAAGGTGGTGGTTATGACTCATGCATACGGGAATCGTTCCGGGGTTCAGTATATGACTGGCGGCCTTAAAGTCTACTATATACCTTGGAAACCGTTTCTTATGCAAAACACATTGCCCACATTTTATGGTACACTTTCCATTATAAGGACAATTCTCATCCGAGAAAAAATATCATTAATAAGTGGACATCAAGCATTCTCAACTCTTTGTCATGAGGCTCATATGCATGCACGCACTATGGGATATAAAGTTGTATTTACTGATCATTCACTCTATGGTTTTGCTGATGCGGGTAGCATTCACATGAACAAGGTGTTACAATTTACTTTAGCAGATGTTACCGAGGCCATTTGGGTTTCTCATACGAGTAAGGAAAGTACAGTTCTAAGGTCGGGCTTGCCGCCCGAAAAGGTGTTTGTTATTCCAAACGCTGTGGACATGGCTATGTTCAAGCCTGCTCAACAGAGACTCTGAAGTGATGAAATTATCATAGTGGTGATAAGTAGATTGGTCTATCGGAAAGGTGCAGATTTGCTAGTTGAGATTATCCCCGAAGTATGCCGGTTGTATCCAATGTGAGAACTTTCA

Network for GWHGAAZE016016

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08288.13	PIGA	46	135	2.90E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03857	PIGA, GPI3	Metabolic pathways	map01100
K03857	PIGA, GPI3	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.059
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.058
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.104
	SRR3591712	Green floral bud	0.039
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.218
	SRR8316896	Juvenile bud stage	0.237
	SRR8316897	Juvenile bud stage	0.201
	SRR8316894	Third green stage	0.187
	SRR8316900	Third green stage	0.368
	SRR8316901	Third green stage	0.312
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.511
	SRR8316903	Complete white stage	0.104
	SRR8316902	Silver flowering stage	0.097
	SRR8316904	Silver flowering stage	0.265
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.344
	SRR8316907	Gold flowering stage	0.213
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.263
	SRR6706287	Light intensity 50%	0.180
	SRR6706288	Light intensity 20%	0.255
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.203
	CNS0095593	Slightly white alabastrum(diploid) 2	0.040
	CNS0095594	Slightly white alabastrum(diploid) 3	0.121
	CNS0095595	Whole white alabastrum(diploid) 2	0.211
	CNS0095596	Whole white alabastrum(diploid) 3	0.224
	CNS0095597	Whole white alabastrum(diploid) 4	0.112
	CNS0095598	Silvery flower (diploied) 1	0.465
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.678
	CNS0095601	Golden flower (diploid) 1	0.585
	CNS0095602	Golden flower (diploid) 2	0.271
	CNS0095603	Golden flower (diploid) 3	0.352
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.024
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.140
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.179
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.524
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.369
	CNS0095612	Silvery flower (tetraploid) 3	0.207
	CNS0095613	Golden flower (tetraploid) 1	0.242
	CNS0095614	Golden flower (tetraploid) 2	0.171
	CNS0095615	Golden flower (tetraploid) 3	0.182
CRA001975	CRR073297	Stem 1	0.281
	CRR073298	Stem 2	0.293
	CRR073299	Stem 3	0.165
	CRR073300	Leaf 1	0.057
	CRR073301	Leaf 2	0.178
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.075
	CRR073306	Third green 1	0.107
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.028
	CRR073309	Second white 1	1.035
	CRR073310	Second white 2	0.078
	CRR073311	Second white 3	0.201
	CRR073312	Silver flowering 1	0.371
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.059
	CRR073316	Gold flowering 2	0.230
	CRR073317	Gold flowering 3	0.033
	CRR073318	Tawny withering 1	0.049
	CRR073319	Tawny withering 2	0.116
	CRR073320	Tawny withering 3	0.000