Gene detail

Detail information of GWHGAAZE015891

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU17663.1	7.39342E-47	hypothetical protein MIMGU_mgv1a011002mg [Erythranthe guttata]
trEMBL	tr\|M1CKG1\|M1CKG1_SOLTU	4E-48	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400069445}
TAIR10	AT1G18340.1	0.000000007	basal transcription factor complex subunit-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	62225882	62226992	-
GWHAAZE00000004	mRNA	62225882	62226992	-
GWHAAZE00000004	exon	62226863	62226992	-
GWHAAZE00000004	exon	62226234	62226322	-
GWHAAZE00000004	exon	62225882	62226148	-
GWHAAZE00000004	CDS	62226863	62226992	-
GWHAAZE00000004	CDS	62226234	62226322	-
GWHAAZE00000004	CDS	62225882	62226148	-

Transcript Sequence
>GWHTAAZE015907 ATGATTTGGGATTGCAAAGTGCTGCTGCATGATCCTTGGGAGTGTCACATCTCCCATGTTGAGAGGCAAGCAAACAAGAGTGCCGATGCTTTGGCAATGGAGGCGCTTAATCTTTATCTGGGATTGCAAAATGATGTGAGCCTTCTGTTGGTGTTAGTCGACACAAATCCATTTTTCTGGAGCACAAGTACACTCTCATTCTCCAAATTCCTCTCTCACGTTCTTTCATTCTTGAACTCAATTCTCTTACTCAACCAGCTCAATCAAGTTGTTGTTATTGCCACTGGTTTCAATTCATGTGACTACGTATATGATTCTTCAGTTGGGGCTTCAAACCAAAGGGCGGAGACTTTGTTGCAGAAATTGGAAGAGTTTGTGGTTAAGGATGAGGAGCTGAGTAAGGAAGAATTTGTTAATGGGATTAGCTCTTCCTTGCTTTCGGGGTCTCTTTCGATGGCACTTTGTTGTATCCTTAATAAAAATTGA

Network for GWHGAAZE015891

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03850.15	Tfb4	46	157	2.50E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03143	TFIIH3, GTF2H3, TFB4	Basal transcription factors	map03022
K03143	TFIIH3, GTF2H3, TFB4	Nucleotide excision repair	map03420

Gene Ontology

GO term	Ontology	Name
GO:0006289	biological_process	nucleotide-excision repair
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0000439	cellular_component	transcription factor TFIIH core complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.944
	SRR3591706	second leaf	4.166
	SRR3591707	mature leaf	4.663
	SRR3591708	Shoot apex	13.137
	SRR3591709	Stem	7.005
	SRR3591710	White floral bud	13.014
	SRR3591711	White flower	7.582
	SRR3591712	Green floral bud	17.228
	SRR3591713	Yellow flower	5.719
SRP173429	SRR8316895	Juvenile bud stage	9.400
	SRR8316896	Juvenile bud stage	12.573
	SRR8316897	Juvenile bud stage	9.129
	SRR8316894	Third green stage	5.058
	SRR8316900	Third green stage	17.921
	SRR8316901	Third green stage	17.709
	SRR8316898	Complete white stage	4.688
	SRR8316899	Complete white stage	9.852
	SRR8316903	Complete white stage	6.091
	SRR8316902	Silver flowering stage	3.557
	SRR8316904	Silver flowering stage	5.886
	SRR8316905	Silver flowering stage	2.730
	SRR8316906	Gold flowering stage	5.997
	SRR8316907	Gold flowering stage	9.316
	SRR8316908	Gold flowering stage	4.618
SRP132670	SRR6706286	Control	6.685
	SRR6706287	Light intensity 50%	5.702
	SRR6706288	Light intensity 20%	6.676
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.841
	CNS0095593	Slightly white alabastrum(diploid) 2	17.019
	CNS0095594	Slightly white alabastrum(diploid) 3	23.072
	CNS0095595	Whole white alabastrum(diploid) 2	22.760
	CNS0095596	Whole white alabastrum(diploid) 3	26.158
	CNS0095597	Whole white alabastrum(diploid) 4	28.132
	CNS0095598	Silvery flower (diploied) 1	6.162
	CNS0095599	Silvery flower (diploied) 2	7.478
	CNS0095600	Silvery flower (diploied) 3	7.463
	CNS0095601	Golden flower (diploid) 1	3.344
	CNS0095602	Golden flower (diploid) 2	7.961
	CNS0095603	Golden flower (diploid) 3	6.546
	CNS0095604	Slightly white alabastrum(tetraploid) 1	22.202
	CNS0095605	Slightly white alabastrum(tetraploid) 2	31.024
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.444
	CNS0095607	Whole white alabastrum(tetraploid) 1	28.202
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.969
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.421
	CNS0095610	Silvery flower (tetraploid) 1	4.987
	CNS0095611	Silvery flower (tetraploid) 2	7.025
	CNS0095612	Silvery flower (tetraploid) 3	4.190
	CNS0095613	Golden flower (tetraploid) 1	3.175
	CNS0095614	Golden flower (tetraploid) 2	3.865
	CNS0095615	Golden flower (tetraploid) 3	4.166
CRA001975	CRR073297	Stem 1	4.413
	CRR073298	Stem 2	5.048
	CRR073299	Stem 3	4.032
	CRR073300	Leaf 1	5.121
	CRR073301	Leaf 2	7.308
	CRR073302	Leaf 3	4.272
	CRR073303	Juvenile bud 1	4.988
	CRR073304	Juvenile bud 2	2.223
	CRR073305	Juvenile bud 3	1.735
	CRR073306	Third green 1	1.309
	CRR073307	Third green 2	1.056
	CRR073308	Third green 3	1.669
	CRR073309	Second white 1	2.239
	CRR073310	Second white 2	1.840
	CRR073311	Second white 3	1.039
	CRR073312	Silver flowering 1	1.321
	CRR073313	Silver flowering 2	0.853
	CRR073314	Silver flowering 3	0.471
	CRR073315	Gold flowering 1	0.494
	CRR073316	Gold flowering 2	2.305
	CRR073317	Gold flowering 3	1.153
	CRR073318	Tawny withering 1	3.016
	CRR073319	Tawny withering 2	1.679
	CRR073320	Tawny withering 3	5.365