Gene detail

Detail information of GWHGAAZE015884

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001239881.1	4.36015E-61	ethylene-responsive transcription factor ERF012-like [Glycine max]
Swissprot	tr\|Q9SFE4\|ERF12_ARATH	9E-47	Ethylene-responsive transcription factor ERF012
trEMBL	tr\|C9WA64\|C9WA64_SOYBN	2E-61	AP2 domain-containing transcription factor 6 {ECO:0000313\|EMBL:ACJ37440.1}
TAIR10	AT1G21910.1	4E-22	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	62107856	62108500	-
GWHAAZE00000004	mRNA	62107856	62108500	-
GWHAAZE00000004	exon	62107856	62108500	-
GWHAAZE00000004	CDS	62107856	62108500	-

Transcript Sequence
>GWHTAAZE015900 ATGGTCAAGAAAGAGCACAAGATTCAATCACAGCCGTCCAAATCAATGCCATCACCATCAGTATCATCAACAACTCCACCACCACAATCATCAGCATCATCAAGCAAAAAGAAGTACAAGGGAGTGAGGATGAGAAGTTGGGGATCATGGGTATCTGAAATAAGAGCACCCAATCAAAAAACAAGGATTTGGTTAGGCTCCTACTCTACTCCTGAGGCAGCTGCTAGAGCCTATGATGCTGCCCTTCTTTGCCTTAAGGGCCCCACAGCCAATCTCAACTTCCCCACCACCACCACCCCCCACCAGTACTCCCCCACAACCATGTCCCCCAAATCCATTCAAAAGATGGCTGCTGCCGCAGCTGCAGCCACCACTGCTGCCACTTCGCCGCCTTCTTCTTCTCTATCCTCCTCCTTTGAATCCTCATCTCCATCCAACTATGTGGAGGATGACAAGTCATTAGTCTCTTCTTTTGAAAACTATACATCTTATGATCAAACAGACGAACAGATGTCTATGACTGCACCATGGTACCATTTTGATTCACCGAAGTACACTGATATGATCAATGGGGCGTTTTTCGATCCGATGATGATCGAAGATGTCTACGAAGAGGACGATATTCGTCTTTGGAGCTTTTGCTGA

Network for GWHGAAZE015884

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	38	87	2.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	51.795
	SRR3591706	second leaf	2.556
	SRR3591707	mature leaf	1.138
	SRR3591708	Shoot apex	6.912
	SRR3591709	Stem	37.996
	SRR3591710	White floral bud	4.867
	SRR3591711	White flower	9.286
	SRR3591712	Green floral bud	2.601
	SRR3591713	Yellow flower	1.771
SRP173429	SRR8316895	Juvenile bud stage	10.899
	SRR8316896	Juvenile bud stage	4.392
	SRR8316897	Juvenile bud stage	4.842
	SRR8316894	Third green stage	6.940
	SRR8316900	Third green stage	15.025
	SRR8316901	Third green stage	26.042
	SRR8316898	Complete white stage	0.749
	SRR8316899	Complete white stage	51.385
	SRR8316903	Complete white stage	0.313
	SRR8316902	Silver flowering stage	0.569
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.060
	SRR8316906	Gold flowering stage	0.197
	SRR8316907	Gold flowering stage	0.729
	SRR8316908	Gold flowering stage	0.076
SRP132670	SRR6706286	Control	8.434
	SRR6706287	Light intensity 50%	6.432
	SRR6706288	Light intensity 20%	4.584
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.211
	CNS0095593	Slightly white alabastrum(diploid) 2	5.062
	CNS0095594	Slightly white alabastrum(diploid) 3	1.223
	CNS0095595	Whole white alabastrum(diploid) 2	2.896
	CNS0095596	Whole white alabastrum(diploid) 3	0.104
	CNS0095597	Whole white alabastrum(diploid) 4	2.500
	CNS0095598	Silvery flower (diploied) 1	36.072
	CNS0095599	Silvery flower (diploied) 2	58.622
	CNS0095600	Silvery flower (diploied) 3	23.762
	CNS0095601	Golden flower (diploid) 1	38.849
	CNS0095602	Golden flower (diploid) 2	13.588
	CNS0095603	Golden flower (diploid) 3	13.099
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.099
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.077
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.158
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.372
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.132
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.417
	CNS0095610	Silvery flower (tetraploid) 1	1.563
	CNS0095611	Silvery flower (tetraploid) 2	0.054
	CNS0095612	Silvery flower (tetraploid) 3	0.696
	CNS0095613	Golden flower (tetraploid) 1	0.373
	CNS0095614	Golden flower (tetraploid) 2	0.103
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	5.425
	CRR073298	Stem 2	3.276
	CRR073299	Stem 3	2.440
	CRR073300	Leaf 1	7.334
	CRR073301	Leaf 2	10.999
	CRR073302	Leaf 3	7.078
	CRR073303	Juvenile bud 1	8.811
	CRR073304	Juvenile bud 2	6.788
	CRR073305	Juvenile bud 3	44.591
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.984
	CRR073309	Second white 1	0.036
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	47.434
	CRR073316	Gold flowering 2	41.265
	CRR073317	Gold flowering 3	36.828
	CRR073318	Tawny withering 1	12.957
	CRR073319	Tawny withering 2	11.430
	CRR073320	Tawny withering 3	22.554