Gene detail

Detail information of GWHGAAZE015601

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009386296.1	2.57333E-70	PREDICTED: vacuolar protein sorting-associated protein 29 [Musa acuminata subsp. malaccensis]
Swissprot	tr\|Q9STT2\|VPS29_ARATH	6E-65	Vacuolar protein sorting-associated protein 29
trEMBL	tr\|I1M7H6\|I1M7H6_SOYBN	7E-71	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA14G05340.2}
TAIR10	AT3G47810.3	5E-52	Calcineurin-like metallo-phosphoesterase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	50111883	50117172	+
GWHAAZE00000004	mRNA	50111883	50117172	+
GWHAAZE00000004	exon	50111883	50112014	+
GWHAAZE00000004	exon	50116942	50117172	+
GWHAAZE00000004	CDS	50111883	50112014	+
GWHAAZE00000004	CDS	50116942	50117172	+

Transcript Sequence
>GWHTAAZE015617 ATGGTATTGGTGTTAGCAATTGGGGATCTTCATATCCCACATAGGGCACCCGATCTCCCTGCCAAGTTCAAATCCATGCTTGTTCCTGGAAAGATTCAGCACATCATATGCACTGGCAATCTGTGTATCAAGGTTGTACCATGGGGAGACCTGGATTCGCTAGCGATGCTGCAGAGACAGTTAGACGTGGACATCCTTGTAAGCGGGCACACCCACCAGTTCAAAGCCTACAAACATGAGGCGGGTGTGGTCATTAACCCAGGCTCAGCCACTGGAGCCTACAGCAGCATAACCTATGACGTTAACCCTAGCTTTGTCCTCATGGACATCGACGGCCTTAGGGTCGCTGCCTATGTCTACTGA

Network for GWHGAAZE015601

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12850.8	Metallophos_2	53	111	5.40E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18467	VPS29	Endocytosis	map04144

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.124
	SRR3591706	second leaf	19.381
	SRR3591707	mature leaf	10.925
	SRR3591708	Shoot apex	24.624
	SRR3591709	Stem	20.256
	SRR3591710	White floral bud	35.105
	SRR3591711	White flower	41.577
	SRR3591712	Green floral bud	22.656
	SRR3591713	Yellow flower	47.511
SRP173429	SRR8316895	Juvenile bud stage	33.476
	SRR8316896	Juvenile bud stage	34.838
	SRR8316897	Juvenile bud stage	22.977
	SRR8316894	Third green stage	19.288
	SRR8316900	Third green stage	77.295
	SRR8316901	Third green stage	79.662
	SRR8316898	Complete white stage	56.846
	SRR8316899	Complete white stage	107.957
	SRR8316903	Complete white stage	62.946
	SRR8316902	Silver flowering stage	57.559
	SRR8316904	Silver flowering stage	58.740
	SRR8316905	Silver flowering stage	38.879
	SRR8316906	Gold flowering stage	128.542
	SRR8316907	Gold flowering stage	113.035
	SRR8316908	Gold flowering stage	126.644
SRP132670	SRR6706286	Control	90.975
	SRR6706287	Light intensity 50%	91.330
	SRR6706288	Light intensity 20%	98.693
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.850
	CNS0095593	Slightly white alabastrum(diploid) 2	45.042
	CNS0095594	Slightly white alabastrum(diploid) 3	40.521
	CNS0095595	Whole white alabastrum(diploid) 2	37.834
	CNS0095596	Whole white alabastrum(diploid) 3	51.253
	CNS0095597	Whole white alabastrum(diploid) 4	36.300
	CNS0095598	Silvery flower (diploied) 1	37.192
	CNS0095599	Silvery flower (diploied) 2	39.159
	CNS0095600	Silvery flower (diploied) 3	85.078
	CNS0095601	Golden flower (diploid) 1	53.605
	CNS0095602	Golden flower (diploid) 2	68.651
	CNS0095603	Golden flower (diploid) 3	68.254
	CNS0095604	Slightly white alabastrum(tetraploid) 1	78.398
	CNS0095605	Slightly white alabastrum(tetraploid) 2	71.562
	CNS0095606	Slightly white alabastrum(tetraploid) 3	92.501
	CNS0095607	Whole white alabastrum(tetraploid) 1	59.484
	CNS0095608	Whole white alabastrum(tetraploid) 2	66.833
	CNS0095609	Whole white alabastrum(tetraploid) 3	110.583
	CNS0095610	Silvery flower (tetraploid) 1	100.443
	CNS0095611	Silvery flower (tetraploid) 2	117.981
	CNS0095612	Silvery flower (tetraploid) 3	123.426
	CNS0095613	Golden flower (tetraploid) 1	101.609
	CNS0095614	Golden flower (tetraploid) 2	104.443
	CNS0095615	Golden flower (tetraploid) 3	155.957
CRA001975	CRR073297	Stem 1	57.824
	CRR073298	Stem 2	46.432
	CRR073299	Stem 3	57.429
	CRR073300	Leaf 1	72.933
	CRR073301	Leaf 2	72.388
	CRR073302	Leaf 3	102.534
	CRR073303	Juvenile bud 1	101.354
	CRR073304	Juvenile bud 2	137.248
	CRR073305	Juvenile bud 3	78.968
	CRR073306	Third green 1	155.834
	CRR073307	Third green 2	113.140
	CRR073308	Third green 3	102.531
	CRR073309	Second white 1	175.788
	CRR073310	Second white 2	120.499
	CRR073311	Second white 3	88.994
	CRR073312	Silver flowering 1	88.378
	CRR073313	Silver flowering 2	95.752
	CRR073314	Silver flowering 3	70.480
	CRR073315	Gold flowering 1	28.315
	CRR073316	Gold flowering 2	28.048
	CRR073317	Gold flowering 3	27.926
	CRR073318	Tawny withering 1	16.385
	CRR073319	Tawny withering 2	22.517
	CRR073320	Tawny withering 3	18.323