Gene detail

Detail information of GWHGAAZE015251

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHN35881.1	7.24504E-51	Cleavage and polyadenylation specificity factor subunit 5 [Glycine soja]
Swissprot	tr\|Q94AF0\|CFIS1_ARATH	3E-49	Pre-mRNA cleavage factor Im 25 kDa subunit 1 {ECO:0000303\|PubMed:18479511}
trEMBL	tr\|A0A059CV41\|A0A059CV41_EUCGR	5E-51	Uncharacterized protein {ECO:0000313\|EMBL:KCW82031.1}
TAIR10	AT4G29820.1	3E-40	homolog of CFIM-25

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	28872698	28876061	+
GWHAAZE00000004	mRNA	28872698	28876061	+
GWHAAZE00000004	exon	28872698	28872742	+
GWHAAZE00000004	exon	28875059	28875152	+
GWHAAZE00000004	exon	28875283	28875356	+
GWHAAZE00000004	exon	28875622	28875694	+
GWHAAZE00000004	exon	28875961	28876061	+
GWHAAZE00000004	CDS	28872698	28872742	+
GWHAAZE00000004	CDS	28875059	28875152	+
GWHAAZE00000004	CDS	28875283	28875356	+
GWHAAZE00000004	CDS	28875622	28875694	+
GWHAAZE00000004	CDS	28875961	28876061	+

Transcript Sequence
>GWHTAAZE015267 TACTCTGCTCACGGGTTGAGGACTTGTGTGGAAGCTGTACTTGTGGTTGAGTTGTTCAAACATCCCCATTTGTTGTTGTTGCAAGTACGAAATTCGAAATATAAGCTTCCAGGGGGACGCTTGAAACCGGGCGAATCAGATGTCGATGGCTTGAAACGTAAACTCTCAAGCAAACTATCTGCAGAAGAAGATAGTATTGGGCTAAACTGGGAGGTGGGAGAATGCCTTGGGATGTGGTGGAGACCCGACTTCGAAACATTGCTTTATCCATACTTGCCCCCTAGCGGAATGTACAAAGCTGTTTCTCGTGAAGTTGCCGGAAAGCCGGAAGTTCATTGTACCAAGAAATTTAAAATTGCTTGCAGTTCCATTGTGCCAAATTCATGA

Network for GWHGAAZE015251

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13869.7	NUDIX_2	1	94	7.80E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14397	NUDT21, CPSF5, CFIM25	mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0006378	biological_process	mRNA polyadenylation
GO:0005849	cellular_component	mRNA cleavage factor complex
GO:0003729	molecular_function	mRNA binding
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.165
	SRR3591706	second leaf	3.758
	SRR3591707	mature leaf	7.291
	SRR3591708	Shoot apex	8.335
	SRR3591709	Stem	13.493
	SRR3591710	White floral bud	13.707
	SRR3591711	White flower	13.978
	SRR3591712	Green floral bud	11.192
	SRR3591713	Yellow flower	16.703
SRP173429	SRR8316895	Juvenile bud stage	6.883
	SRR8316896	Juvenile bud stage	8.365
	SRR8316897	Juvenile bud stage	4.622
	SRR8316894	Third green stage	4.015
	SRR8316900	Third green stage	9.357
	SRR8316901	Third green stage	8.083
	SRR8316898	Complete white stage	8.053
	SRR8316899	Complete white stage	18.317
	SRR8316903	Complete white stage	9.565
	SRR8316902	Silver flowering stage	5.660
	SRR8316904	Silver flowering stage	8.033
	SRR8316905	Silver flowering stage	2.830
	SRR8316906	Gold flowering stage	12.449
	SRR8316907	Gold flowering stage	14.337
	SRR8316908	Gold flowering stage	12.273
SRP132670	SRR6706286	Control	13.121
	SRR6706287	Light intensity 50%	12.126
	SRR6706288	Light intensity 20%	12.908
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.230
	CNS0095593	Slightly white alabastrum(diploid) 2	10.108
	CNS0095594	Slightly white alabastrum(diploid) 3	6.802
	CNS0095595	Whole white alabastrum(diploid) 2	6.757
	CNS0095596	Whole white alabastrum(diploid) 3	7.507
	CNS0095597	Whole white alabastrum(diploid) 4	8.677
	CNS0095598	Silvery flower (diploied) 1	16.535
	CNS0095599	Silvery flower (diploied) 2	11.278
	CNS0095600	Silvery flower (diploied) 3	18.294
	CNS0095601	Golden flower (diploid) 1	19.691
	CNS0095602	Golden flower (diploid) 2	15.319
	CNS0095603	Golden flower (diploid) 3	13.545
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.953
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.171
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.429
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.718
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.089
	CNS0095610	Silvery flower (tetraploid) 1	35.365
	CNS0095611	Silvery flower (tetraploid) 2	26.255
	CNS0095612	Silvery flower (tetraploid) 3	11.131
	CNS0095613	Golden flower (tetraploid) 1	18.394
	CNS0095614	Golden flower (tetraploid) 2	24.177
	CNS0095615	Golden flower (tetraploid) 3	9.466
CRA001975	CRR073297	Stem 1	12.999
	CRR073298	Stem 2	12.294
	CRR073299	Stem 3	9.399
	CRR073300	Leaf 1	12.276
	CRR073301	Leaf 2	13.441
	CRR073302	Leaf 3	10.447
	CRR073303	Juvenile bud 1	9.992
	CRR073304	Juvenile bud 2	9.063
	CRR073305	Juvenile bud 3	10.529
	CRR073306	Third green 1	4.060
	CRR073307	Third green 2	4.581
	CRR073308	Third green 3	5.029
	CRR073309	Second white 1	2.998
	CRR073310	Second white 2	4.464
	CRR073311	Second white 3	2.169
	CRR073312	Silver flowering 1	2.778
	CRR073313	Silver flowering 2	3.572
	CRR073314	Silver flowering 3	2.457
	CRR073315	Gold flowering 1	6.718
	CRR073316	Gold flowering 2	5.217
	CRR073317	Gold flowering 3	7.278
	CRR073318	Tawny withering 1	13.060
	CRR073319	Tawny withering 2	18.387
	CRR073320	Tawny withering 3	10.503