Gene detail

Detail information of GWHGAAZE015173

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AJB84618.1	9.33578E-74	1-deoxy-D-xylulose-5-phosphate synthase, partial [Camellia sinensis]
Swissprot	tr\|Q6YU51\|DXS2_ORYSJ	1E-62	Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic (Precursor)
trEMBL	tr\|Q2HXK2\|Q2HXK2_CHRMO	8E-72	1-deoxyxylulose 5-phosphate synthase {ECO:0000313\|EMBL:BAE79547.1}
TAIR10	AT4G15560.1	2E-46	Deoxyxylulose-5-phosphate synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	26934090	26934771	+
GWHAAZE00000004	mRNA	26934090	26934771	+
GWHAAZE00000004	exon	26934090	26934356	+
GWHAAZE00000004	exon	26934625	26934771	+
GWHAAZE00000004	CDS	26934090	26934356	+
GWHAAZE00000004	CDS	26934625	26934771	+

Transcript Sequence
>GWHTAAZE015189 ATGGAAGGCAATAGAGTGGCAATACTTGGCTATGGTTCAATAGTACAACAATGCGTAGAGGCTGCAGGCTTTCTGATCAAATCCCACAACATATTTACGACTGTGGCCGATGCTCGCTTCTGCAAGCCGTTGGATGCTGATTTGATTAAACGGTTGGAAAACGAGCACGAGATCTTGATCACAGTAGAGGAAGGCTCGGTCGGAGGGTTTGGATCCCACATAGCCCATTTCCTAACATTGAATGGTATTCTTGATGGAAAGCTAAAGTTGAGAGCAATGGTACTTCCGGATAGATACATCAACCATGGAGCGCCCCAAGATCAGATGGAAGAGGCTGGTCTTTCTTCGAGGCATATATGCGCGACGGTTTTGTCGCTATTGGGTAGGCCTAAAGAAGCTCTTCAAGTTCAGTGA

Network for GWHGAAZE015173

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02780.21	Transketolase_C	2	119	2.70E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01662	dxs	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Thiamine metabolism	map00730
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.672
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.261
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.322
	SRR3591711	White flower	0.391
	SRR3591712	Green floral bud	0.647
	SRR3591713	Yellow flower	0.593
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.012
	SRR8316900	Third green stage	0.015
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.361
	SRR8316899	Complete white stage	0.069
	SRR8316903	Complete white stage	0.927
	SRR8316902	Silver flowering stage	0.676
	SRR8316904	Silver flowering stage	4.050
	SRR8316905	Silver flowering stage	0.453
	SRR8316906	Gold flowering stage	4.008
	SRR8316907	Gold flowering stage	2.968
	SRR8316908	Gold flowering stage	0.270
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.006
	SRR6706288	Light intensity 20%	0.007
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.093
	CNS0095598	Silvery flower (diploied) 1	0.023
	CNS0095599	Silvery flower (diploied) 2	0.207
	CNS0095600	Silvery flower (diploied) 3	0.486
	CNS0095601	Golden flower (diploid) 1	0.027
	CNS0095602	Golden flower (diploid) 2	0.163
	CNS0095603	Golden flower (diploid) 3	0.309
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.233
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.562
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.383
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.600
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.550
	CNS0095610	Silvery flower (tetraploid) 1	0.016
	CNS0095611	Silvery flower (tetraploid) 2	0.895
	CNS0095612	Silvery flower (tetraploid) 3	2.712
	CNS0095613	Golden flower (tetraploid) 1	0.131
	CNS0095614	Golden flower (tetraploid) 2	1.599
	CNS0095615	Golden flower (tetraploid) 3	1.012
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.128
	CRR073304	Juvenile bud 2	0.037
	CRR073305	Juvenile bud 3	0.012
	CRR073306	Third green 1	2.503
	CRR073307	Third green 2	4.177
	CRR073308	Third green 3	1.061
	CRR073309	Second white 1	5.268
	CRR073310	Second white 2	5.668
	CRR073311	Second white 3	4.609
	CRR073312	Silver flowering 1	4.396
	CRR073313	Silver flowering 2	7.491
	CRR073314	Silver flowering 3	2.792
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.037
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000