Gene detail

Detail information of GWHGAAZE013524

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU22423.1	1.1594E-164	hypothetical protein MIMGU_mgv1a012069mg [Erythranthe guttata]
Swissprot	tr\|Q9AST3\|SBH2_ARATH	3E-152	Sphinganine C(4)-monooxygenase 2
trEMBL	tr\|A0A022Q5G0\|A0A022Q5G0_ERYGU	4E-165	Uncharacterized protein {ECO:0000313\|EMBL:EYU22423.1}
TAIR10	AT1G14290.1	1E-120	sphingoid base hydroxylase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	103826935	103828659	-
GWHAAZE00000003	mRNA	103826935	103828659	-
GWHAAZE00000003	exon	103826935	103827486	-
GWHAAZE00000003	exon	103828438	103828659	-
GWHAAZE00000003	CDS	103828438	103828659	-
GWHAAZE00000003	CDS	103826935	103827486	-

Transcript Sequence
>GWHTAAZE013538 ATGGAATTCCGTTTATCGGACGAGTTGTTGGGGACTGTGATGCCGATTCTGGTGTATTGGCTGTATTCTGGAATTTACGTCCTTTTTGGATCGTTTGAAAATTATAGGTTACATTCGAAAAAGGATGAGGATGATAAAAATTCGGTATCAAAGGCTACTGTGGTGAAGGGTGTTCTTCTCCAACAGGCTGTTCAGGCTACCGTCGCAATCATTCTCTTCACTGTAACCGGAAATGACATCGATCCTAACATAGGTCAACAGTCTTCCCTTGTTCTCGCAAGACAATTCTTTATTGCAATGATGGTCTTGGATACTTGGCAATATTTTATGCATAGGTACATGCACCATAACAAGTTCTTGTACCGGCATATACATTCTCAACATCACCGCCTTGTTGTACCCTATGCATTTGGAGCTCTGTACAACCACCCGATAGAGGGACTTCTCCTTGACACAATTGGAGGGGCTCTATCTTTCCTTCTCTCAGGCATGTCCCCTCGTGCTTCCATTTTCTTCTTCTCCTTTGCTACCATCAAAACAGTTGATGACCATTGTGGATTGTGGCTGCCTGGGAACCTTTTCCATATCTTTTTTAGAAACAACTCTGCCTATCATGACATTCACCACCAGCTTTATGGCAGCAAATATAACTTTTCACAGCCATTTTTTGTTATGTGGGATAGAATCCTCGGTACTTACATGCCTTATTCACTTGAGAAAAGAGCAAGTGGGGGTTTTGAAGCACGACCTAGTAAAGATTGCAAGGACAATTGA

Network for GWHGAAZE013524

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04116.14	FA_hydroxylase	97	232	5.70E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04713	SUR2	Metabolic pathways	map01100
K04713	SUR2	Sphingolipid metabolism	map00600

Gene Ontology

GO term	Ontology	Name
GO:0008610	biological_process	lipid biosynthetic process
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.754
	SRR3591706	second leaf	8.240
	SRR3591707	mature leaf	12.158
	SRR3591708	Shoot apex	14.586
	SRR3591709	Stem	34.612
	SRR3591710	White floral bud	24.133
	SRR3591711	White flower	22.605
	SRR3591712	Green floral bud	37.137
	SRR3591713	Yellow flower	23.666
SRP173429	SRR8316895	Juvenile bud stage	26.541
	SRR8316896	Juvenile bud stage	23.503
	SRR8316897	Juvenile bud stage	22.333
	SRR8316894	Third green stage	9.937
	SRR8316900	Third green stage	27.469
	SRR8316901	Third green stage	26.919
	SRR8316898	Complete white stage	9.676
	SRR8316899	Complete white stage	58.305
	SRR8316903	Complete white stage	12.596
	SRR8316902	Silver flowering stage	9.544
	SRR8316904	Silver flowering stage	9.071
	SRR8316905	Silver flowering stage	6.038
	SRR8316906	Gold flowering stage	24.063
	SRR8316907	Gold flowering stage	15.884
	SRR8316908	Gold flowering stage	20.600
SRP132670	SRR6706286	Control	17.076
	SRR6706287	Light intensity 50%	19.389
	SRR6706288	Light intensity 20%	22.144
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.891
	CNS0095593	Slightly white alabastrum(diploid) 2	46.563
	CNS0095594	Slightly white alabastrum(diploid) 3	32.799
	CNS0095595	Whole white alabastrum(diploid) 2	36.757
	CNS0095596	Whole white alabastrum(diploid) 3	29.771
	CNS0095597	Whole white alabastrum(diploid) 4	27.420
	CNS0095598	Silvery flower (diploied) 1	41.179
	CNS0095599	Silvery flower (diploied) 2	30.159
	CNS0095600	Silvery flower (diploied) 3	30.468
	CNS0095601	Golden flower (diploid) 1	42.190
	CNS0095602	Golden flower (diploid) 2	39.110
	CNS0095603	Golden flower (diploid) 3	38.991
	CNS0095604	Slightly white alabastrum(tetraploid) 1	28.897
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.754
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.826
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.767
	CNS0095608	Whole white alabastrum(tetraploid) 2	29.161
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.182
	CNS0095610	Silvery flower (tetraploid) 1	24.039
	CNS0095611	Silvery flower (tetraploid) 2	25.573
	CNS0095612	Silvery flower (tetraploid) 3	26.519
	CNS0095613	Golden flower (tetraploid) 1	15.592
	CNS0095614	Golden flower (tetraploid) 2	15.849
	CNS0095615	Golden flower (tetraploid) 3	18.320
CRA001975	CRR073297	Stem 1	24.263
	CRR073298	Stem 2	20.237
	CRR073299	Stem 3	22.618
	CRR073300	Leaf 1	25.897
	CRR073301	Leaf 2	25.946
	CRR073302	Leaf 3	25.275
	CRR073303	Juvenile bud 1	31.687
	CRR073304	Juvenile bud 2	35.227
	CRR073305	Juvenile bud 3	30.628
	CRR073306	Third green 1	34.873
	CRR073307	Third green 2	41.770
	CRR073308	Third green 3	32.423
	CRR073309	Second white 1	33.853
	CRR073310	Second white 2	23.158
	CRR073311	Second white 3	19.167
	CRR073312	Silver flowering 1	41.190
	CRR073313	Silver flowering 2	33.083
	CRR073314	Silver flowering 3	34.033
	CRR073315	Gold flowering 1	30.810
	CRR073316	Gold flowering 2	45.027
	CRR073317	Gold flowering 3	33.120
	CRR073318	Tawny withering 1	41.750
	CRR073319	Tawny withering 2	77.858
	CRR073320	Tawny withering 3	52.092