Gene detail

Detail information of GWHGAAZE012828

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004135048.1	7.4613E-47	PREDICTED: cytosolic 5'-nucleotidase 3-like [Cucumis sativus]
trEMBL	tr\|A0A0A0KRD5\|A0A0A0KRD5_CUCSA	3E-47	Uncharacterized protein {ECO:0000313\|EMBL:KGN52168.1}
TAIR10	AT2G38680.1	6E-33	5'-nucleotidases;magnesium ion binding

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	92263739	92266042	+
GWHAAZE00000003	mRNA	92263739	92266042	+
GWHAAZE00000003	exon	92263739	92263788	+
GWHAAZE00000003	exon	92264546	92264752	+
GWHAAZE00000003	exon	92265964	92266042	+
GWHAAZE00000003	CDS	92263739	92263788	+
GWHAAZE00000003	CDS	92264546	92264752	+
GWHAAZE00000003	CDS	92265964	92266042	+

Transcript Sequence
>GWHTAAZE012842 ATGAATAAGACATTAGTTCTCGAGCATGCTACATTCGTTGTTTGTACTCTGAAGATAATTCATAGTTTGAATAAGAATGAGCATGCTCTTGATATGGCTGCACCACTCCACGATCAATTGGGTGAAGTTGATGTTCCCATTGATGAGAATGCCTCGATAAAAAAACGAACTAATGTGCTTCTTCTTGGTGATCACATTGGAGACTTGGGAATGTCTGACGGTTTAAACTATGAGACTCGAATATCTGTCGGCTTTCTGAATGACAACATTGAGAGTTCTCTTGATAGCTACCGAAAAGCCTTTGATGTGGTGTATCTGGTGAGTGAAATGCCTTGA

Network for GWHGAAZE012828

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05822.13	UMPH-1	18	106	7.00E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01081	E3.1.3.5	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Pyrimidine metabolism	map00240
		Nicotinate and nicotinamide metabolism	map00760

Gene Ontology

GO term	Ontology	Name
GO:0005737	cellular_component	cytoplasm
GO:0000287	molecular_function	magnesium ion binding
GO:0008253	molecular_function	5'-nucleotidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.934
	SRR3591706	second leaf	1.980
	SRR3591707	mature leaf	1.315
	SRR3591708	Shoot apex	7.757
	SRR3591709	Stem	3.153
	SRR3591710	White floral bud	8.657
	SRR3591711	White flower	8.622
	SRR3591712	Green floral bud	18.645
	SRR3591713	Yellow flower	2.710
SRP173429	SRR8316895	Juvenile bud stage	1.415
	SRR8316896	Juvenile bud stage	3.728
	SRR8316897	Juvenile bud stage	0.638
	SRR8316894	Third green stage	1.085
	SRR8316900	Third green stage	2.974
	SRR8316901	Third green stage	2.674
	SRR8316898	Complete white stage	1.952
	SRR8316899	Complete white stage	8.238
	SRR8316903	Complete white stage	3.971
	SRR8316902	Silver flowering stage	0.845
	SRR8316904	Silver flowering stage	1.327
	SRR8316905	Silver flowering stage	0.688
	SRR8316906	Gold flowering stage	1.262
	SRR8316907	Gold flowering stage	1.476
	SRR8316908	Gold flowering stage	0.824
SRP132670	SRR6706286	Control	0.140
	SRR6706287	Light intensity 50%	0.185
	SRR6706288	Light intensity 20%	0.213
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.775
	CNS0095593	Slightly white alabastrum(diploid) 2	2.180
	CNS0095594	Slightly white alabastrum(diploid) 3	1.353
	CNS0095595	Whole white alabastrum(diploid) 2	4.156
	CNS0095596	Whole white alabastrum(diploid) 3	1.606
	CNS0095597	Whole white alabastrum(diploid) 4	1.109
	CNS0095598	Silvery flower (diploied) 1	2.967
	CNS0095599	Silvery flower (diploied) 2	0.954
	CNS0095600	Silvery flower (diploied) 3	2.281
	CNS0095601	Golden flower (diploid) 1	0.655
	CNS0095602	Golden flower (diploid) 2	0.445
	CNS0095603	Golden flower (diploid) 3	1.109
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.839
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.387
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.274
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.165
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.294
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.065
	CNS0095610	Silvery flower (tetraploid) 1	2.498
	CNS0095611	Silvery flower (tetraploid) 2	2.753
	CNS0095612	Silvery flower (tetraploid) 3	4.851
	CNS0095613	Golden flower (tetraploid) 1	0.827
	CNS0095614	Golden flower (tetraploid) 2	0.630
	CNS0095615	Golden flower (tetraploid) 3	0.378
CRA001975	CRR073297	Stem 1	2.433
	CRR073298	Stem 2	0.545
	CRR073299	Stem 3	0.859
	CRR073300	Leaf 1	2.782
	CRR073301	Leaf 2	1.750
	CRR073302	Leaf 3	1.851
	CRR073303	Juvenile bud 1	0.999
	CRR073304	Juvenile bud 2	2.228
	CRR073305	Juvenile bud 3	0.068
	CRR073306	Third green 1	0.665
	CRR073307	Third green 2	0.049
	CRR073308	Third green 3	0.233
	CRR073309	Second white 1	0.563
	CRR073310	Second white 2	1.802
	CRR073311	Second white 3	0.109
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	1.205
	CRR073314	Silver flowering 3	0.226
	CRR073315	Gold flowering 1	1.996
	CRR073316	Gold flowering 2	0.586
	CRR073317	Gold flowering 3	1.574
	CRR073318	Tawny withering 1	0.758
	CRR073319	Tawny withering 2	1.503
	CRR073320	Tawny withering 3	1.136