Gene detail

Detail information of GWHGAAZE012537

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010259378.1	2.7701E-101	PREDICTED: transcription repressor MYB4-like [Nelumbo nucifera]
Swissprot	tr\|Q9SZP1\|MYB4_ARATH	1E-72	Transcription repressor MYB4
trEMBL	tr\|B9HW79\|B9HW79_POPTR	2E-97	Uncharacterized protein {ECO:0000313\|EMBL:EEF02061.2}
TAIR10	AT4G38620.1	1E-59	myb domain protein 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	87433035	87434695	-
GWHAAZE00000003	mRNA	87433035	87434695	-
GWHAAZE00000003	exon	87433035	87433464	-
GWHAAZE00000003	exon	87434248	87434377	-
GWHAAZE00000003	exon	87434566	87434695	-
GWHAAZE00000003	CDS	87434566	87434695	-
GWHAAZE00000003	CDS	87434248	87434377	-
GWHAAZE00000003	CDS	87433035	87433464	-

Transcript Sequence
>GWHTAAZE012551 ATGAGGAAACCATGTTGCGATAAAAAGGACATAAACAAAGGGGCCTGGTCCAAGCAAGAAGATGAAATGCTTATCGATTACATCCGCACACACGGGGAAGGCCATTGGCGCTCTCTCCCTAAGGCTGCCGGCCTACTACGCTGTGGTAAAAGTTGCAGACTGAGATGGGTAAATTATCTCAGACCAGACCTCAAAAGAGGCAATTTTGGTGAAGACGAAGAAGATCTCATCATGAAGCTTCATTCACTCCTAGGCAATCGGTGGTCTTTGATTGCTGGAAGATTGCCCGGACGAACCGACAACGAAGTGAAGAACTATTGGAATTCTCATCTAAGAAGAAAGCTTATAAACAAGGGTGTAACTGATGCAAATAAGCATCGCTTGATTCAAAATCTATCTTGTCATTCAAATCCCGACTTGCCTGATAGTGCGACATCATCGAAAATTCATGCATGCCAACCCGTGAGATCTCGCAGTGAAAATGATCATATCTCGGACGCAGCAAGTTGTTTAGAGGATGATAATACAAGTGGATTAATGCCTAATTTGAACCTTGACCTCACAATTACAATTCCTTCTAATTCAAATATTTGTGTTGATAAGGAGGTGAAAAAAGATAAGGAATGTACAACAATAACAGGAGAATTACCAGAGTCTGCCCCATCTCCCACGCTTAACCTTTTTAGGTGA

Network for GWHGAAZE012537

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	13	60	3.30E-13
PF00249.32	Myb_DNA-binding	66	111	7.00E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.454
	SRR3591709	Stem	0.737
	SRR3591710	White floral bud	2.044
	SRR3591711	White flower	3.840
	SRR3591712	Green floral bud	0.276
	SRR3591713	Yellow flower	57.623
SRP173429	SRR8316895	Juvenile bud stage	0.283
	SRR8316896	Juvenile bud stage	0.568
	SRR8316897	Juvenile bud stage	0.151
	SRR8316894	Third green stage	0.122
	SRR8316900	Third green stage	0.278
	SRR8316901	Third green stage	0.398
	SRR8316898	Complete white stage	0.227
	SRR8316899	Complete white stage	0.599
	SRR8316903	Complete white stage	0.617
	SRR8316902	Silver flowering stage	0.139
	SRR8316904	Silver flowering stage	0.714
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	1.898
	SRR8316907	Gold flowering stage	2.089
	SRR8316908	Gold flowering stage	11.490
SRP132670	SRR6706286	Control	0.461
	SRR6706287	Light intensity 50%	0.521
	SRR6706288	Light intensity 20%	0.298
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.562
	CNS0095593	Slightly white alabastrum(diploid) 2	1.608
	CNS0095594	Slightly white alabastrum(diploid) 3	1.924
	CNS0095595	Whole white alabastrum(diploid) 2	2.655
	CNS0095596	Whole white alabastrum(diploid) 3	3.675
	CNS0095597	Whole white alabastrum(diploid) 4	3.786
	CNS0095598	Silvery flower (diploied) 1	3.929
	CNS0095599	Silvery flower (diploied) 2	2.574
	CNS0095600	Silvery flower (diploied) 3	0.752
	CNS0095601	Golden flower (diploid) 1	1.014
	CNS0095602	Golden flower (diploid) 2	0.861
	CNS0095603	Golden flower (diploid) 3	1.604
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.699
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.694
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.929
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.589
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.447
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.518
	CNS0095610	Silvery flower (tetraploid) 1	2.145
	CNS0095611	Silvery flower (tetraploid) 2	2.327
	CNS0095612	Silvery flower (tetraploid) 3	6.641
	CNS0095613	Golden flower (tetraploid) 1	72.283
	CNS0095614	Golden flower (tetraploid) 2	29.312
	CNS0095615	Golden flower (tetraploid) 3	24.829
CRA001975	CRR073297	Stem 1	1.292
	CRR073298	Stem 2	0.710
	CRR073299	Stem 3	0.244
	CRR073300	Leaf 1	0.253
	CRR073301	Leaf 2	1.197
	CRR073302	Leaf 3	0.405
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.086
	CRR073305	Juvenile bud 3	0.183
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.394
	CRR073308	Third green 3	0.006
	CRR073309	Second white 1	6.155
	CRR073310	Second white 2	3.994
	CRR073311	Second white 3	7.211
	CRR073312	Silver flowering 1	15.766
	CRR073313	Silver flowering 2	12.919
	CRR073314	Silver flowering 3	17.272
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.545
	CRR073318	Tawny withering 1	0.068
	CRR073319	Tawny withering 2	1.688
	CRR073320	Tawny withering 3	0.149