Gene detail

Detail information of GWHGAAZE012248

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008223239.1	2.3749E-137	PREDICTED: sucrose synthase 2 [Prunus mume]
Swissprot	tr\|Q00917\|SUS2_ARATH	2E-129	Sucrose synthase 2
trEMBL	tr\|A0A067G063\|A0A067G063_CITSI	2E-135	Sucrose synthase {ECO:0000256\|RuleBase:RU280817}
TAIR10	AT5G49190.1	2E-108	sucrose synthase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	82479395	82480468	-
GWHAAZE00000003	mRNA	82479395	82480468	-
GWHAAZE00000003	exon	82479395	82479554	-
GWHAAZE00000003	exon	82479642	82479886	-
GWHAAZE00000003	exon	82480187	82480468	-
GWHAAZE00000003	CDS	82480187	82480468	-
GWHAAZE00000003	CDS	82479642	82479886	-
GWHAAZE00000003	CDS	82479395	82479554	-

Transcript Sequence
>GWHTAAZE012262 ATGGCAAGGCTCGACAGGGTGAAAAACCTAACCGGGTTGGTCGAGTGTTATGGTAGAAATGCAAAGCTGAGAGAGTTGGCTAATCTTGTTGTGGTTGGTGGTTACATTGATGCAAGTAAATCTAGGGACAGGGAAGAAATTTCGGAGATTGAGAAGATGCACAGCCTCATAAAAGAATACAACTTGCATGGTAAATTCCGATGGATAACGGCTCAAATGAACCGTGCTCACAATGGCGAGCTTTATCGCTATATAGCAGATACAAGAGGCATTTTTGTTCAGCCCGCTTTCTATGAAGCCTTTGGGCTTACAGTTGTTGAGGCCATGACTTGTGGGCTTCCTACATTTGCCACCTGTCATGGCGGCCCCGCTGAGATAATCGAGCACAGTGTTTCGGGATTCCACATCGACCCTTATCACCTTGATCAAGTTTCTACCCTTTTGGTTGAATTCTTTGAACTATCGCAAAATGAACCAAGCTATTGGGACAAAATCTGTGATGGAGGACTTAAACGTATCCATGAAAGGTATACGTGGAAGATATACTCCGAGAGGCTTCTTGCATTATCTGGGGTTTATGGGTTTTGGAAGTATGTGTCAAAGCTTGACAGGCGTGAGACAAGACGATACCTTGAAATGTTCTACATTCTCAAGTATAAAGATCTGGTAGGTACTCTAATAAAATGA

Network for GWHGAAZE012248

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00534.21	Glycos_transf_1	1	161	1.60E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00695	E2.4.1.13	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.119
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.037
	SRR3591709	Stem	0.373
	SRR3591710	White floral bud	0.058
	SRR3591711	White flower	0.313
	SRR3591712	Green floral bud	0.249
	SRR3591713	Yellow flower	0.218
SRP173429	SRR8316895	Juvenile bud stage	3.253
	SRR8316896	Juvenile bud stage	2.285
	SRR8316897	Juvenile bud stage	0.666
	SRR8316894	Third green stage	1.930
	SRR8316900	Third green stage	3.320
	SRR8316901	Third green stage	3.769
	SRR8316898	Complete white stage	0.326
	SRR8316899	Complete white stage	2.061
	SRR8316903	Complete white stage	0.392
	SRR8316902	Silver flowering stage	0.277
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.100
	SRR8316906	Gold flowering stage	0.490
	SRR8316907	Gold flowering stage	0.102
	SRR8316908	Gold flowering stage	0.147
SRP132670	SRR6706286	Control	1.395
	SRR6706287	Light intensity 50%	1.739
	SRR6706288	Light intensity 20%	2.356
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.392
	CNS0095593	Slightly white alabastrum(diploid) 2	3.503
	CNS0095594	Slightly white alabastrum(diploid) 3	3.517
	CNS0095595	Whole white alabastrum(diploid) 2	3.143
	CNS0095596	Whole white alabastrum(diploid) 3	4.199
	CNS0095597	Whole white alabastrum(diploid) 4	4.840
	CNS0095598	Silvery flower (diploied) 1	1.257
	CNS0095599	Silvery flower (diploied) 2	1.307
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	2.503
	CNS0095602	Golden flower (diploid) 2	1.177
	CNS0095603	Golden flower (diploid) 3	0.232
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.935
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.060
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.208
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.139
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.766
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.931
	CNS0095610	Silvery flower (tetraploid) 1	0.154
	CNS0095611	Silvery flower (tetraploid) 2	0.284
	CNS0095612	Silvery flower (tetraploid) 3	0.437
	CNS0095613	Golden flower (tetraploid) 1	0.006
	CNS0095614	Golden flower (tetraploid) 2	0.138
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	4.759
	CRR073298	Stem 2	3.662
	CRR073299	Stem 3	0.133
	CRR073300	Leaf 1	3.681
	CRR073301	Leaf 2	2.497
	CRR073302	Leaf 3	0.109
	CRR073303	Juvenile bud 1	0.281
	CRR073304	Juvenile bud 2	1.103
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.087
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	3.002
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.052
	CRR073319	Tawny withering 2	0.556
	CRR073320	Tawny withering 3	0.411