Gene detail

Detail information of GWHGAAZE011763

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009587300.1	1.28E-132	PREDICTED: 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2 {ECO:0000255\|HAMAP-Rule:MF_03154} [Nicotiana tomentosiformis]
Swissprot	tr\|F6HDT7\|MTND2_VITVI	4E-133	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2 {ECO:0000255\|HAMAP-Rule:MF_03154}
trEMBL	tr\|B9RTK2\|B9RTK2_RICCO	1E-130	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase {ECO:0000256\|HAMAP-Rule:MF_03154}
TAIR10	AT4G14710.2	1E-99	RmlC-like cupins superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	72816915	72820049	-
GWHAAZE00000003	mRNA	72816915	72820049	-
GWHAAZE00000003	exon	72816915	72816981	-
GWHAAZE00000003	exon	72817081	72817151	-
GWHAAZE00000003	exon	72817752	72817876	-
GWHAAZE00000003	exon	72817955	72818069	-
GWHAAZE00000003	exon	72818202	72818296	-
GWHAAZE00000003	exon	72818374	72818485	-
GWHAAZE00000003	exon	72820032	72820049	-
GWHAAZE00000003	CDS	72820032	72820049	-
GWHAAZE00000003	CDS	72818374	72818485	-
GWHAAZE00000003	CDS	72818202	72818296	-
GWHAAZE00000003	CDS	72817955	72818069	-
GWHAAZE00000003	CDS	72817752	72817876	-
GWHAAZE00000003	CDS	72817081	72817151	-
GWHAAZE00000003	CDS	72816915	72816981	-

Transcript Sequence
>GWHTAAZE011775 ATGGGGTCTACAGGCAAGGATGAGAGAGAGGAAGTGATACAAGCATGGTACATGGATGATAGTGATGAAGACCAAAGATTGCCCCATCATCGAGATCCTAAAGAATTTGTGTCCCTCGACAAACTTTCTGAATTTGGGGTGCTGAGCTGGCGATTAGATGCTGATAAATATGAAACAGACGAAGAGTTGAAGAAAATCCGTGAAGCCCGAGGATATTCCTACATGGATTTTTGTGAGGTTTGCCCCGAAAAACTGCCTAATTATGAGGAGAAGATCAAAAGTTTTTTTGAAGAACATCTTCACACTGATGAGGAGATTCGCTACTGTATCGCTGGAAGTGGTTATTTCGATGTGAGGGATCATAATGATGCTTGGATCCGTGTGTGGGTAAAGAAAGGGGGAATGATAGTACTACCTGCTGGAATTTATCACCGCTTTACACTTGATACGGACAACTACATTAAGGCAATGCGGCTGTTTGTTGGCGAACCGGTTTGGACTCCATTTAATCGTCCCCATGATCATCTGCCTGCACGAAAAGAGTATATTGAGGCGTTTGTGCAGAAGGAAGCTGCTAATAATACTGTCAATGCTGCTGCTTGA

Network for GWHGAAZE011763

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03079.15	ARD	14	168	1.10E-65

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08967	mtnD, mtnZ, ADI1	Metabolic pathways	map01100
K08967	mtnD, mtnZ, ADI1	Cysteine and methionine metabolism	map00270

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0019509	biological_process	L-methionine salvage from methylthioadenosine
GO:0010309	molecular_function	acireductone dioxygenase [iron(II)-requiring] activity
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	155.492
	SRR3591706	second leaf	131.606
	SRR3591707	mature leaf	205.486
	SRR3591708	Shoot apex	140.381
	SRR3591709	Stem	188.742
	SRR3591710	White floral bud	88.490
	SRR3591711	White flower	115.932
	SRR3591712	Green floral bud	74.412
	SRR3591713	Yellow flower	109.814
SRP173429	SRR8316895	Juvenile bud stage	76.464
	SRR8316896	Juvenile bud stage	97.500
	SRR8316897	Juvenile bud stage	62.942
	SRR8316894	Third green stage	42.270
	SRR8316900	Third green stage	137.248
	SRR8316901	Third green stage	116.946
	SRR8316898	Complete white stage	52.070
	SRR8316899	Complete white stage	171.823
	SRR8316903	Complete white stage	86.769
	SRR8316902	Silver flowering stage	54.582
	SRR8316904	Silver flowering stage	69.936
	SRR8316905	Silver flowering stage	27.612
	SRR8316906	Gold flowering stage	124.564
	SRR8316907	Gold flowering stage	137.678
	SRR8316908	Gold flowering stage	125.744
SRP132670	SRR6706286	Control	77.398
	SRR6706287	Light intensity 50%	79.633
	SRR6706288	Light intensity 20%	83.319
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	106.813
	CNS0095593	Slightly white alabastrum(diploid) 2	105.715
	CNS0095594	Slightly white alabastrum(diploid) 3	99.551
	CNS0095595	Whole white alabastrum(diploid) 2	103.402
	CNS0095596	Whole white alabastrum(diploid) 3	91.922
	CNS0095597	Whole white alabastrum(diploid) 4	80.973
	CNS0095598	Silvery flower (diploied) 1	179.966
	CNS0095599	Silvery flower (diploied) 2	151.352
	CNS0095600	Silvery flower (diploied) 3	136.685
	CNS0095601	Golden flower (diploid) 1	186.571
	CNS0095602	Golden flower (diploid) 2	175.410
	CNS0095603	Golden flower (diploid) 3	165.862
	CNS0095604	Slightly white alabastrum(tetraploid) 1	99.036
	CNS0095605	Slightly white alabastrum(tetraploid) 2	97.645
	CNS0095606	Slightly white alabastrum(tetraploid) 3	158.047
	CNS0095607	Whole white alabastrum(tetraploid) 1	71.504
	CNS0095608	Whole white alabastrum(tetraploid) 2	77.851
	CNS0095609	Whole white alabastrum(tetraploid) 3	129.401
	CNS0095610	Silvery flower (tetraploid) 1	144.958
	CNS0095611	Silvery flower (tetraploid) 2	145.216
	CNS0095612	Silvery flower (tetraploid) 3	108.437
	CNS0095613	Golden flower (tetraploid) 1	120.137
	CNS0095614	Golden flower (tetraploid) 2	154.441
	CNS0095615	Golden flower (tetraploid) 3	119.328
CRA001975	CRR073297	Stem 1	75.645
	CRR073298	Stem 2	69.755
	CRR073299	Stem 3	68.771
	CRR073300	Leaf 1	64.579
	CRR073301	Leaf 2	61.526
	CRR073302	Leaf 3	65.433
	CRR073303	Juvenile bud 1	69.676
	CRR073304	Juvenile bud 2	55.149
	CRR073305	Juvenile bud 3	64.885
	CRR073306	Third green 1	36.910
	CRR073307	Third green 2	42.965
	CRR073308	Third green 3	35.207
	CRR073309	Second white 1	59.662
	CRR073310	Second white 2	58.236
	CRR073311	Second white 3	39.903
	CRR073312	Silver flowering 1	42.316
	CRR073313	Silver flowering 2	36.624
	CRR073314	Silver flowering 3	33.287
	CRR073315	Gold flowering 1	80.463
	CRR073316	Gold flowering 2	111.788
	CRR073317	Gold flowering 3	78.006
	CRR073318	Tawny withering 1	94.418
	CRR073319	Tawny withering 2	98.811
	CRR073320	Tawny withering 3	89.134