Gene detail

Detail information of GWHGAAZE011732

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011091067.1	2.67433E-62	PREDICTED: calmodulin-like protein 11 [Sesamum indicum]
Swissprot	tr\|P93171\|CALM_HELAN	2E-55	Calmodulin
trEMBL	tr\|M1BCF9\|M1BCF9_SOLTU	4E-61	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400042063}
TAIR10	AT2G27030.3	3E-44	calmodulin 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	72162116	72162984	+
GWHAAZE00000003	mRNA	72162116	72162984	+
GWHAAZE00000003	exon	72162116	72162191	+
GWHAAZE00000003	exon	72162578	72162735	+
GWHAAZE00000003	exon	72162844	72162984	+
GWHAAZE00000003	CDS	72162116	72162191	+
GWHAAZE00000003	CDS	72162578	72162735	+
GWHAAZE00000003	CDS	72162844	72162984	+

Transcript Sequence
>GWHTAAZE011744 ATGGCAGAGGTATTGAATGAAAACCAGATTGTTGAGTTTCAAGAAGCTTTTAGTCTGTTTGACAAAGATGGAGATGGTTGCATTACAGTCGAAGAATTAGCTACGGTAATCAGGTCGCTCGACCAAAATCCAACCGAGGAAGAACTTCAAGACATGCTCAATGAAGTTGATGCTGATGGAAATGGGACCATAGAATTTGTAGAGTTCTTGAATCTAATGGCCAAGAAAATGAAGGATAATGATGTAGAAGAAGAGCTTAAAGAAGCTTTCAAGGTGTTTGACAAGGATCAAAATGGTTATATATCAGCTAATGAGGTAGACTCTTGCTTCTATATATGCAGTCTTTTTCATGCCAAATTAATAATATTTTCTTAG

Network for GWHGAAZE011732

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	13	73	9.30E-16
PF00036.33	EF-hand_1	85	107	4.20E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.673
	SRR3591706	second leaf	9.496
	SRR3591707	mature leaf	3.026
	SRR3591708	Shoot apex	14.493
	SRR3591709	Stem	5.997
	SRR3591710	White floral bud	3.418
	SRR3591711	White flower	7.131
	SRR3591712	Green floral bud	2.721
	SRR3591713	Yellow flower	5.975
SRP173429	SRR8316895	Juvenile bud stage	9.980
	SRR8316896	Juvenile bud stage	26.966
	SRR8316897	Juvenile bud stage	4.397
	SRR8316894	Third green stage	7.748
	SRR8316900	Third green stage	2.484
	SRR8316901	Third green stage	2.607
	SRR8316898	Complete white stage	0.383
	SRR8316899	Complete white stage	3.658
	SRR8316903	Complete white stage	0.888
	SRR8316902	Silver flowering stage	0.797
	SRR8316904	Silver flowering stage	1.670
	SRR8316905	Silver flowering stage	0.395
	SRR8316906	Gold flowering stage	4.247
	SRR8316907	Gold flowering stage	1.291
	SRR8316908	Gold flowering stage	5.379
SRP132670	SRR6706286	Control	4.075
	SRR6706287	Light intensity 50%	4.780
	SRR6706288	Light intensity 20%	4.473
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.189
	CNS0095593	Slightly white alabastrum(diploid) 2	4.483
	CNS0095594	Slightly white alabastrum(diploid) 3	4.968
	CNS0095595	Whole white alabastrum(diploid) 2	3.203
	CNS0095596	Whole white alabastrum(diploid) 3	0.166
	CNS0095597	Whole white alabastrum(diploid) 4	2.309
	CNS0095598	Silvery flower (diploied) 1	5.607
	CNS0095599	Silvery flower (diploied) 2	1.883
	CNS0095600	Silvery flower (diploied) 3	1.103
	CNS0095601	Golden flower (diploid) 1	9.932
	CNS0095602	Golden flower (diploid) 2	2.473
	CNS0095603	Golden flower (diploid) 3	1.570
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.823
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.622
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.767
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.505
	CNS0095610	Silvery flower (tetraploid) 1	0.316
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.191
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.506
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.207
	CRR073298	Stem 2	1.573
	CRR073299	Stem 3	0.266
	CRR073300	Leaf 1	2.467
	CRR073301	Leaf 2	1.631
	CRR073302	Leaf 3	1.242
	CRR073303	Juvenile bud 1	0.235
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	1.329
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	1.148
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.960
	CRR073316	Gold flowering 2	4.039
	CRR073317	Gold flowering 3	3.070
	CRR073318	Tawny withering 1	2.948
	CRR073319	Tawny withering 2	4.095
	CRR073320	Tawny withering 3	0.121