Gene detail

Detail information of GWHGAAZE011072

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007034372.1	2.4322E-124	Calcium-binding EF-hand family protein isoform 1 [Theobroma cacao]
Swissprot	tr\|Q9LRN6\|CML22_ARATH	2E-80	Probable calcium-binding protein CML22
trEMBL	tr\|A0A061EKW4\|A0A061EKW4_THECC	9E-125	Calcium-binding EF-hand family protein isoform 1 {ECO:0000313\|EMBL:EOY05298.1}
TAIR10	AT3G24110.1	5E-65	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	41382418	41384466	-
GWHAAZE00000003	mRNA	41382418	41384466	-
GWHAAZE00000003	exon	41382418	41382542	-
GWHAAZE00000003	exon	41382924	41383098	-
GWHAAZE00000003	exon	41383703	41383905	-
GWHAAZE00000003	exon	41384280	41384466	-
GWHAAZE00000003	CDS	41384280	41384466	-
GWHAAZE00000003	CDS	41383703	41383905	-
GWHAAZE00000003	CDS	41382924	41383098	-
GWHAAZE00000003	CDS	41382418	41382542	-

Transcript Sequence
>GWHTAAZE011084 ATGCTTTGTTGTGGTGCTTCGCCGAACAAGTATGAGAGATTAGATACTAAGCTCGAAAAGAAAATGATGGAGGTTAAGAGAAGTTCATCAGGGCCTAACAATTTTCGATCAATCGATAGCATAATACTGAGGTTCCCTCAATTCAAAGAGGGATTGAAAGAGATCAGAGGCGTATTTGAAGATTATGATGAAGATTCTAATGGAACCATTGACCATGAGGAGCTCAAGAAATGCTTAAACAAATTGCAACTTCATCTTACGGAGGAAGAAATTGATGATCTTTTTGATTCATGTGACATGGACGGGCGCGAAGGGATACAATTTAATGAGTTTATTGTTCTTCTCTGCCTCATCTATCTCCTCATGGATCCTACAACCTCTCCTCAAAAGGCGTCAGAGATGGGTTCGCCGCAGCTGAAAGCAACATTTGATACCATAATTGAAGCATTCATGTTTCTTGATAAAAATGGTGATGGAAAGCTGAACAAGAAAGAGATGGTCAAGGCGTTGAATGATGCTTCTCCTTGGGAAAAATCCCCTGCACACATTACCAGAAATCGATTCAAGGAAATGGACTGGGACAAGAATGGGAAAGTCAGCTTCAGGGAATTCCTCTTTGCTTTGGTCAACTGGGTTGGAATCGACAGTGATGATGAAATCCCAATCACAGGAAGTTCGGGAGATCAATGA

Network for GWHGAAZE011072

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13833.7	EF-hand_8	67	115	1.10E-08
PF13499.7	EF-hand_7	144	207	1.60E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	24.619
	SRR3591706	second leaf	18.721
	SRR3591707	mature leaf	29.455
	SRR3591708	Shoot apex	24.761
	SRR3591709	Stem	66.190
	SRR3591710	White floral bud	20.262
	SRR3591711	White flower	25.610
	SRR3591712	Green floral bud	16.278
	SRR3591713	Yellow flower	44.664
SRP173429	SRR8316895	Juvenile bud stage	7.905
	SRR8316896	Juvenile bud stage	11.514
	SRR8316897	Juvenile bud stage	3.313
	SRR8316894	Third green stage	4.059
	SRR8316900	Third green stage	13.475
	SRR8316901	Third green stage	11.923
	SRR8316898	Complete white stage	5.709
	SRR8316899	Complete white stage	10.590
	SRR8316903	Complete white stage	9.838
	SRR8316902	Silver flowering stage	2.418
	SRR8316904	Silver flowering stage	3.422
	SRR8316905	Silver flowering stage	3.133
	SRR8316906	Gold flowering stage	6.169
	SRR8316907	Gold flowering stage	6.977
	SRR8316908	Gold flowering stage	4.447
SRP132670	SRR6706286	Control	9.045
	SRR6706287	Light intensity 50%	10.309
	SRR6706288	Light intensity 20%	9.247
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.068
	CNS0095593	Slightly white alabastrum(diploid) 2	13.693
	CNS0095594	Slightly white alabastrum(diploid) 3	12.995
	CNS0095595	Whole white alabastrum(diploid) 2	11.840
	CNS0095596	Whole white alabastrum(diploid) 3	9.617
	CNS0095597	Whole white alabastrum(diploid) 4	11.218
	CNS0095598	Silvery flower (diploied) 1	15.197
	CNS0095599	Silvery flower (diploied) 2	13.918
	CNS0095600	Silvery flower (diploied) 3	17.325
	CNS0095601	Golden flower (diploid) 1	19.486
	CNS0095602	Golden flower (diploid) 2	18.685
	CNS0095603	Golden flower (diploid) 3	16.938
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.508
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.020
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.924
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.919
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.605
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.788
	CNS0095610	Silvery flower (tetraploid) 1	10.604
	CNS0095611	Silvery flower (tetraploid) 2	15.056
	CNS0095612	Silvery flower (tetraploid) 3	14.921
	CNS0095613	Golden flower (tetraploid) 1	8.435
	CNS0095614	Golden flower (tetraploid) 2	9.653
	CNS0095615	Golden flower (tetraploid) 3	22.474
CRA001975	CRR073297	Stem 1	13.247
	CRR073298	Stem 2	9.724
	CRR073299	Stem 3	12.897
	CRR073300	Leaf 1	10.179
	CRR073301	Leaf 2	7.996
	CRR073302	Leaf 3	7.513
	CRR073303	Juvenile bud 1	10.258
	CRR073304	Juvenile bud 2	9.749
	CRR073305	Juvenile bud 3	7.464
	CRR073306	Third green 1	2.522
	CRR073307	Third green 2	8.493
	CRR073308	Third green 3	4.580
	CRR073309	Second white 1	9.617
	CRR073310	Second white 2	7.068
	CRR073311	Second white 3	2.187
	CRR073312	Silver flowering 1	3.975
	CRR073313	Silver flowering 2	5.729
	CRR073314	Silver flowering 3	1.745
	CRR073315	Gold flowering 1	27.839
	CRR073316	Gold flowering 2	34.105
	CRR073317	Gold flowering 3	20.511
	CRR073318	Tawny withering 1	11.780
	CRR073319	Tawny withering 2	13.819
	CRR073320	Tawny withering 3	20.885