Gene detail

Detail information of GWHGAAZE011033

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007045415.1	2.75819E-91	NAD(P)-linked oxidoreductase superfamily protein, putative [Theobroma cacao]
Swissprot	tr\|O49133\|GALUR_FRAAN	1E-88	D-galacturonate reductase
trEMBL	tr\|A0A061EA55\|A0A061EA55_THECC	1E-91	NAD(P)-linked oxidoreductase superfamily protein, putative {ECO:0000313\|EMBL:EOY01247.1}
TAIR10	AT1G59950.1	3E-49	NAD(P)-linked oxidoreductase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	39696099	39697351	+
GWHAAZE00000003	mRNA	39696099	39697351	+
GWHAAZE00000003	exon	39696099	39696281	+
GWHAAZE00000003	exon	39696767	39696922	+
GWHAAZE00000003	exon	39697139	39697351	+
GWHAAZE00000003	CDS	39696099	39696281	+
GWHAAZE00000003	CDS	39696767	39696922	+
GWHAAZE00000003	CDS	39697139	39697351	+

Transcript Sequence
>GWHTAAZE011045 ATGATACGCCAAACCCCTGTTCCTTTTGAAATTATACAACCCTTAGATCTCAAGTCTGTCTGGGCTGGAATGGAAGAGTGCCAGAATCTTGGACTCACCAAGGGCATTGGTGTCAGCAATTTCTCTTCCACGAGAATTGAGGACCTCCTCTCTATTGCCAACATCCCTCCTGCTATTAATCAACAAAAGCAGCTGAGGGAGTTCTGCAAGTCAAAGGGTATTCATGTAACTGCATACTCACCTTTGGGTGCAAATGGTACTAAATGGGGAGACAATAGAATTATGGAGTGCGATGTTCTTAAGGAGATTGCCAAGGCCAAAGGCAAATCCGCTACTCAGATTTCTTTGAGGTGGGTATACGAGCAAGGGGCTAGTTTGGTAGCAAAGAGCTACAACAAGGAACGGATGAGGGAAAACCTTGAGATATTTGATTTTTCACTCACAGAGGAAGAGTCCTACAAGATCTCACAGCTTCCCCAGCACAAAGGGGTCACTTTCGAACCAGTTTTGGGAGCTCACCCTTTGGTTCTGGAGATCGATGAAGAGATCTAA

Network for GWHGAAZE011033

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00248.22	Aldo_ket_red	17	157	1.80E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19642	GALUR	Ascorbate and aldarate metabolism	map00053

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.568
	SRR3591706	second leaf	5.634
	SRR3591707	mature leaf	1.182
	SRR3591708	Shoot apex	7.142
	SRR3591709	Stem	4.900
	SRR3591710	White floral bud	9.650
	SRR3591711	White flower	10.898
	SRR3591712	Green floral bud	12.848
	SRR3591713	Yellow flower	26.283
SRP173429	SRR8316895	Juvenile bud stage	4.158
	SRR8316896	Juvenile bud stage	7.117
	SRR8316897	Juvenile bud stage	9.537
	SRR8316894	Third green stage	2.268
	SRR8316900	Third green stage	5.586
	SRR8316901	Third green stage	5.931
	SRR8316898	Complete white stage	3.347
	SRR8316899	Complete white stage	8.754
	SRR8316903	Complete white stage	1.288
	SRR8316902	Silver flowering stage	4.072
	SRR8316904	Silver flowering stage	4.739
	SRR8316905	Silver flowering stage	1.333
	SRR8316906	Gold flowering stage	13.805
	SRR8316907	Gold flowering stage	11.537
	SRR8316908	Gold flowering stage	36.358
SRP132670	SRR6706286	Control	5.681
	SRR6706287	Light intensity 50%	3.875
	SRR6706288	Light intensity 20%	2.661
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.006
	CNS0095593	Slightly white alabastrum(diploid) 2	16.188
	CNS0095594	Slightly white alabastrum(diploid) 3	10.602
	CNS0095595	Whole white alabastrum(diploid) 2	9.349
	CNS0095596	Whole white alabastrum(diploid) 3	8.101
	CNS0095597	Whole white alabastrum(diploid) 4	5.319
	CNS0095598	Silvery flower (diploied) 1	4.388
	CNS0095599	Silvery flower (diploied) 2	2.762
	CNS0095600	Silvery flower (diploied) 3	3.804
	CNS0095601	Golden flower (diploid) 1	2.318
	CNS0095602	Golden flower (diploid) 2	2.722
	CNS0095603	Golden flower (diploid) 3	3.066
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.059
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.869
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.177
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.761
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.261
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.507
	CNS0095610	Silvery flower (tetraploid) 1	27.267
	CNS0095611	Silvery flower (tetraploid) 2	19.960
	CNS0095612	Silvery flower (tetraploid) 3	15.659
	CNS0095613	Golden flower (tetraploid) 1	25.000
	CNS0095614	Golden flower (tetraploid) 2	27.153
	CNS0095615	Golden flower (tetraploid) 3	4.243
CRA001975	CRR073297	Stem 1	4.148
	CRR073298	Stem 2	3.713
	CRR073299	Stem 3	1.321
	CRR073300	Leaf 1	2.962
	CRR073301	Leaf 2	4.610
	CRR073302	Leaf 3	2.762
	CRR073303	Juvenile bud 1	1.901
	CRR073304	Juvenile bud 2	1.541
	CRR073305	Juvenile bud 3	1.839
	CRR073306	Third green 1	1.180
	CRR073307	Third green 2	0.182
	CRR073308	Third green 3	0.438
	CRR073309	Second white 1	0.261
	CRR073310	Second white 2	1.039
	CRR073311	Second white 3	0.173
	CRR073312	Silver flowering 1	1.523
	CRR073313	Silver flowering 2	4.344
	CRR073314	Silver flowering 3	4.504
	CRR073315	Gold flowering 1	4.536
	CRR073316	Gold flowering 2	5.771
	CRR073317	Gold flowering 3	4.472
	CRR073318	Tawny withering 1	21.916
	CRR073319	Tawny withering 2	37.165
	CRR073320	Tawny withering 3	3.912