Gene detail

Detail information of GWHGAAZE010883

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006423404.1	2.87893E-35	hypothetical protein CICLE_v10027828mg [Citrus clementina]
Swissprot	tr\|Q9SJT7\|VHAA2_ARATH	2E-35	V-type proton ATPase subunit a2
trEMBL	tr\|V4UBK8\|V4UBK8_9ROSI	1E-35	V-type proton ATPase subunit a {ECO:0000256\|RuleBase:RU361189}
TAIR10	AT2G21410.1	2E-31	vacuolar proton ATPase A2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	31352017	31352727	-
GWHAAZE00000003	mRNA	31352017	31352727	-
GWHAAZE00000003	exon	31352710	31352727	-
GWHAAZE00000003	exon	31352346	31352458	-
GWHAAZE00000003	exon	31352017	31352242	-
GWHAAZE00000003	CDS	31352710	31352727	-
GWHAAZE00000003	CDS	31352346	31352458	-
GWHAAZE00000003	CDS	31352017	31352242	-

Transcript Sequence
>GWHTAAZE010895 ATGTACCTCCATCTCCAGGCGAAGCGGGAGAAATCCATTTACTACATTCTAAACATGTTTAGCATTGATGTGACAAAGAAGTGTCTTGTGGGAGAAGGGTGGAGCCCTGTGTTTGCAATAAAACCGGTATTAGTATGGATGAAAAGTATAATCTTTCATGGGACAAAAAATTTCTGCTTCAAACAAGGAGTTTTATTTGTGCAGATTCAGGATGCACTGCAGAGGGCAACAAGGGACTCCAACTCACAAGTTGGTGCTAGTCTCCAAGTTTTGCGTACGAAAGAGTTACCACCAACTTATTTTTGGACGAACAAATTTACTTCAGCTTTTCAAGAGATTGTTGATGTGTATGGGTGA

Network for GWHGAAZE010883

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01496.20	V_ATPase_I	67	118	7.70E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02154	ATPeV0A, ATP6N	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.580
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.041
	SRR3591708	Shoot apex	0.468
	SRR3591709	Stem	0.397
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.545
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.187
	SRR8316901	Third green stage	0.109
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.052
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.077
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.405
SRP132670	SRR6706286	Control	0.023
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.120
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.026
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.064
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.049
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.501
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.061
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.412
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.968
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.595
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.733
	CNS0095610	Silvery flower (tetraploid) 1	1.977
	CNS0095611	Silvery flower (tetraploid) 2	2.667
	CNS0095612	Silvery flower (tetraploid) 3	1.192
	CNS0095613	Golden flower (tetraploid) 1	0.359
	CNS0095614	Golden flower (tetraploid) 2	1.421
	CNS0095615	Golden flower (tetraploid) 3	0.595
CRA001975	CRR073297	Stem 1	0.084
	CRR073298	Stem 2	0.043
	CRR073299	Stem 3	0.075
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.318
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.381
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.155
	CRR073309	Second white 1	0.126
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.124
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.153
	CRR073316	Gold flowering 2	0.661
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.067
	CRR073319	Tawny withering 2	0.062
	CRR073320	Tawny withering 3	0.171