Gene detail

Detail information of GWHGAAZE010636

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU40500.1	9.05112E-58	hypothetical protein MIMGU_mgv1a019953mg, partial [Erythranthe guttata]
Swissprot	tr\|A4UHT7\|SALR_PAPBR	3E-20	Salutaridine reductase {ECO:0000312\|EMBL:ABO93462.1}
trEMBL	tr\|A0A022RNK3\|A0A022RNK3_ERYGU	3E-58	Uncharacterized protein {ECO:0000313\|EMBL:EYU40500.1} (Fragment)
TAIR10	AT3G59710.1	5E-33	NAD(P)-binding Rossmann-fold superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	16315667	16316029	+
GWHAAZE00000003	mRNA	16315667	16316029	+
GWHAAZE00000003	exon	16315667	16316029	+
GWHAAZE00000003	CDS	16315667	16316029	+

Transcript Sequence
>GWHTAAZE010648 ATGAACGAAGAGACGTTAACAGAAGAGAAAATAGAGGGGATGGTGTGTTTGTTTCTCGAGAATGTGAAGAATGGGACATGGAAAAACCAAGGGTGGCCTGAGTTATGGACAGATTATGCTGTCTCAAAGCTTGCCTTGAATTCTTATTCCAATCTTTTGGCTAAAAAGTACAAAGGGAGGGGCCTAAGTGTAAATTGCTTTTGTCCTGGTTTCACTCAGACCTCAATGACTAACGGCCAGGGAACTCACACCGCGGCGGAGGCCGCTGAAATGGTGGCTGCGCTGGCATTGCTGCCGCCGGAGAAACTGCCCACTGGAAAATTCTATCTTGGGTCTAGCCGTGGTGTATTATCTAAGTTGTAG

Network for GWHGAAZE010636

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00106.26	adh_short	35	80	1.40E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00079	CBR1	Metabolic pathways	map01100
		Arachidonic acid metabolism	map00590
		Folate biosynthesis	map00790
		Metabolism of xenobiotics by cytochrome P450	map00980

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.462
	SRR3591709	Stem	0.490
	SRR3591710	White floral bud	0.829
	SRR3591711	White flower	0.037
	SRR3591712	Green floral bud	8.413
	SRR3591713	Yellow flower	1.971
SRP173429	SRR8316895	Juvenile bud stage	17.627
	SRR8316896	Juvenile bud stage	11.809
	SRR8316897	Juvenile bud stage	6.050
	SRR8316894	Third green stage	3.161
	SRR8316900	Third green stage	0.851
	SRR8316901	Third green stage	1.987
	SRR8316898	Complete white stage	0.139
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.228
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.317
	SRR8316905	Silver flowering stage	0.727
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.947
SRP132670	SRR6706286	Control	1.244
	SRR6706287	Light intensity 50%	0.921
	SRR6706288	Light intensity 20%	1.444
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.009
	CNS0095593	Slightly white alabastrum(diploid) 2	13.279
	CNS0095594	Slightly white alabastrum(diploid) 3	11.414
	CNS0095595	Whole white alabastrum(diploid) 2	0.458
	CNS0095596	Whole white alabastrum(diploid) 3	1.559
	CNS0095597	Whole white alabastrum(diploid) 4	0.678
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.746
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.110
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.249
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.518
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.196
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.684
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.491
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.804
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.345
	CNS0095610	Silvery flower (tetraploid) 1	0.483
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	2.270
	CNS0095613	Golden flower (tetraploid) 1	0.444
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.225
CRA001975	CRR073297	Stem 1	17.808
	CRR073298	Stem 2	12.427
	CRR073299	Stem 3	17.312
	CRR073300	Leaf 1	0.992
	CRR073301	Leaf 2	0.566
	CRR073302	Leaf 3	1.066
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.301
	CRR073306	Third green 1	2.355
	CRR073307	Third green 2	4.125
	CRR073308	Third green 3	2.038
	CRR073309	Second white 1	0.756
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.418
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.208
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.044