Gene detail

Detail information of GWHGAAZE010207

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAP56262.1	4.35406E-92	PSII D2 [Pyrus communis]
Swissprot	tr\|A4QLI9\|PSBD_LOBMA	7E-93	Photosystem II D2 protein {ECO:0000255\|HAMAP-Rule:MF_01383}
trEMBL	tr\|W5EN71\|W5EN71_WHEAT	6E-93	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Traes_4DL_F75FD0600.1}
TAIR10	ATCG00270.1	3E-68	photosystem II reaction center protein D

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	124039196	124039609	+
GWHAAZE00000002	mRNA	124039196	124039609	+
GWHAAZE00000002	exon	124039196	124039609	+
GWHAAZE00000002	CDS	124039196	124039609	+

Transcript Sequence
>GWHTAAZE010219 ATGTTACGTCAATTCGAACTTGCTCGATCTGTTCAATTGCGACCTTATAATGCAATCGCATTCTCTGGCCCAATTGCTGTTTTTGTTTCTGTATTCCTGATTTATCCACTAGGTCAGTCTGGTTGGTTCTTTGCACCTAGTTTTGGTGTAGCGGCTATATTCCGATTCATCCTCTTTTTTCAAGGATTTCATAATTGGACGTTGAACCCATTTCATATGATGGGAGTTGCCGGTGTATTGGGCGCTGCTTTGCTATGCGCTATTCATGGTGCTACCGTAGAAAATACTTTATTTGAAGATGGTGATGGTGCAAATACATTCCGTGCGTTTAACCCAACCCAAGCTGAAGAAACTTATTCAATGGTCACCGCTAACCGCTTTTGGTCCCAAATCTTTGGGGTTGCTTTTCAATAA

Network for GWHGAAZE010207

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00124.20	Photo_RC	1	134	3.50E-43

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02706	psbD	Metabolic pathways	map01100
K02706	psbD	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009772	biological_process	photosynthetic electron transport in photosystem II
GO:0019684	biological_process	photosynthesis, light reaction
GO:0045156	molecular_function	electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.877
	SRR3591706	second leaf	2.280
	SRR3591707	mature leaf	2.669
	SRR3591708	Shoot apex	1.268
	SRR3591709	Stem	0.488
	SRR3591710	White floral bud	0.240
	SRR3591711	White flower	0.433
	SRR3591712	Green floral bud	0.091
	SRR3591713	Yellow flower	0.359
SRP173429	SRR8316895	Juvenile bud stage	12.876
	SRR8316896	Juvenile bud stage	6.367
	SRR8316897	Juvenile bud stage	21.443
	SRR8316894	Third green stage	15.814
	SRR8316900	Third green stage	1.527
	SRR8316901	Third green stage	1.277
	SRR8316898	Complete white stage	6.238
	SRR8316899	Complete white stage	0.323
	SRR8316903	Complete white stage	4.993
	SRR8316902	Silver flowering stage	12.218
	SRR8316904	Silver flowering stage	11.401
	SRR8316905	Silver flowering stage	8.963
	SRR8316906	Gold flowering stage	0.598
	SRR8316907	Gold flowering stage	0.391
	SRR8316908	Gold flowering stage	0.295
SRP132670	SRR6706286	Control	0.386
	SRR6706287	Light intensity 50%	0.462
	SRR6706288	Light intensity 20%	0.514
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.860
	CNS0095593	Slightly white alabastrum(diploid) 2	5.300
	CNS0095594	Slightly white alabastrum(diploid) 3	5.517
	CNS0095595	Whole white alabastrum(diploid) 2	6.276
	CNS0095596	Whole white alabastrum(diploid) 3	4.510
	CNS0095597	Whole white alabastrum(diploid) 4	4.645
	CNS0095598	Silvery flower (diploied) 1	5.626
	CNS0095599	Silvery flower (diploied) 2	6.598
	CNS0095600	Silvery flower (diploied) 3	3.864
	CNS0095601	Golden flower (diploid) 1	8.228
	CNS0095602	Golden flower (diploid) 2	2.422
	CNS0095603	Golden flower (diploid) 3	3.148
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.402
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.361
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.393
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.972
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.800
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.442
	CNS0095610	Silvery flower (tetraploid) 1	4.325
	CNS0095611	Silvery flower (tetraploid) 2	5.222
	CNS0095612	Silvery flower (tetraploid) 3	3.371
	CNS0095613	Golden flower (tetraploid) 1	13.109
	CNS0095614	Golden flower (tetraploid) 2	5.795
	CNS0095615	Golden flower (tetraploid) 3	2.579
CRA001975	CRR073297	Stem 1	5.348
	CRR073298	Stem 2	5.839
	CRR073299	Stem 3	2.558
	CRR073300	Leaf 1	2.588
	CRR073301	Leaf 2	1.194
	CRR073302	Leaf 3	1.221
	CRR073303	Juvenile bud 1	1.714
	CRR073304	Juvenile bud 2	2.464
	CRR073305	Juvenile bud 3	4.475
	CRR073306	Third green 1	3.720
	CRR073307	Third green 2	0.921
	CRR073308	Third green 3	4.300
	CRR073309	Second white 1	10.062
	CRR073310	Second white 2	27.896
	CRR073311	Second white 3	55.235
	CRR073312	Silver flowering 1	39.598
	CRR073313	Silver flowering 2	13.523
	CRR073314	Silver flowering 3	20.539
	CRR073315	Gold flowering 1	62.354
	CRR073316	Gold flowering 2	97.350
	CRR073317	Gold flowering 3	150.350
	CRR073318	Tawny withering 1	2.994
	CRR073319	Tawny withering 2	2.351
	CRR073320	Tawny withering 3	2.851