Gene detail

Detail information of GWHGAAZE010185

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006841199.1	1.2785E-150	hypothetical protein AMTR_s00334p00014280 [Amborella trichopoda]
Swissprot	tr\|Q49KZ4\|NDHK_EUCGG	9E-87	NAD(P)H-quinone oxidoreductase subunit K, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01356}
trEMBL	tr\|W1P5D9\|W1P5D9_AMBTC	5E-151	Uncharacterized protein {ECO:0000313\|EMBL:ERN02874.1}
TAIR10	ATCG00430.1	6E-64	photosystem II reaction center protein G

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123926029	123927036	+
GWHAAZE00000002	mRNA	123926029	123927036	+
GWHAAZE00000002	exon	123926029	123926428	+
GWHAAZE00000002	exon	123926738	123927036	+
GWHAAZE00000002	CDS	123926029	123926428	+
GWHAAZE00000002	CDS	123926738	123927036	+

Transcript Sequence
>GWHTAAZE010197 ATGAAAATGGCTCCTTCTTTAGTGAGATTATATGAGCAAATGCCTGAACCAAAATATGTTATTGCTATGGGGGCATGTACAATTACAGGGGGGATGTTCAGTACCGATTCTTATAGTACTGTTCGGGGAGTCGATAAGCTAATTCCGGTGGATGTCTATTTGCCGGGCTGTCCGCCTAAACCGGAAGCGGTTATCGATGCTATAACAAAACTTCGTAAGAAAATATCTCGAGAAATCTATGAAGATAGAATTAGGTATCAACAGGAAAATCGGTGTTTTACTACCAATCACAAGTTTCAGGTTTGGCGTAGTAGTCATACTGGAAATTATGATCAAGGATTCCTTTATCAAGTGCCACCTACTTCAGAGATCCCTCCTGAAACATTTTTCAAATACAAAGCACCTGGCGGACTGTTAGCAAGTGTGTATCATCTTACGAGAATAGAGTATGGCGTGGATCAACCAGAAGAGGTATGCATAAAAGTATTTGCCCCGAGGAGGAATCCTAGAATTCCGTCTGTTTTCTGGGTTTGGAAAAGTGTAGATTTTCAAGAACGGGAATCTTATGATATGTTGGGAATCTCTTATGATAATCATCCACGTTTGAAACGTATCTTAATGCCTGAAAATTGGATAGGATGGCCTTTACGTAAGGATTATATTGCCCCCAATTTTTATGAAATACAAGATGCTCATTGA

Network for GWHGAAZE010185

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01058.23	Oxidored_q6	3	71	7.20E-19
PF00329.20	Complex1_30kDa	139	222	2.70E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05582	ndhK	Metabolic pathways	map01100
K05582	ndhK	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016651	molecular_function	oxidoreductase activity, acting on NAD(P)H
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity
GO:0048038	molecular_function	quinone binding
GO:0051539	molecular_function	4 iron, 4 sulfur cluster binding
GO:0051536	molecular_function	iron-sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.643
	SRR3591706	second leaf	1.913
	SRR3591707	mature leaf	2.868
	SRR3591708	Shoot apex	1.166
	SRR3591709	Stem	0.395
	SRR3591710	White floral bud	0.206
	SRR3591711	White flower	0.200
	SRR3591712	Green floral bud	0.193
	SRR3591713	Yellow flower	0.250
SRP173429	SRR8316895	Juvenile bud stage	4.378
	SRR8316896	Juvenile bud stage	1.912
	SRR8316897	Juvenile bud stage	6.102
	SRR8316894	Third green stage	5.902
	SRR8316900	Third green stage	1.090
	SRR8316901	Third green stage	0.979
	SRR8316898	Complete white stage	3.675
	SRR8316899	Complete white stage	0.464
	SRR8316903	Complete white stage	2.209
	SRR8316902	Silver flowering stage	4.347
	SRR8316904	Silver flowering stage	3.985
	SRR8316905	Silver flowering stage	3.689
	SRR8316906	Gold flowering stage	0.608
	SRR8316907	Gold flowering stage	0.854
	SRR8316908	Gold flowering stage	0.616
SRP132670	SRR6706286	Control	0.205
	SRR6706287	Light intensity 50%	0.277
	SRR6706288	Light intensity 20%	0.175
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.143
	CNS0095593	Slightly white alabastrum(diploid) 2	1.490
	CNS0095594	Slightly white alabastrum(diploid) 3	2.271
	CNS0095595	Whole white alabastrum(diploid) 2	2.861
	CNS0095596	Whole white alabastrum(diploid) 3	2.293
	CNS0095597	Whole white alabastrum(diploid) 4	2.078
	CNS0095598	Silvery flower (diploied) 1	1.595
	CNS0095599	Silvery flower (diploied) 2	2.819
	CNS0095600	Silvery flower (diploied) 3	1.403
	CNS0095601	Golden flower (diploid) 1	1.944
	CNS0095602	Golden flower (diploid) 2	1.476
	CNS0095603	Golden flower (diploid) 3	0.622
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.549
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.534
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.329
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.508
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.338
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.102
	CNS0095610	Silvery flower (tetraploid) 1	0.699
	CNS0095611	Silvery flower (tetraploid) 2	0.719
	CNS0095612	Silvery flower (tetraploid) 3	0.712
	CNS0095613	Golden flower (tetraploid) 1	2.068
	CNS0095614	Golden flower (tetraploid) 2	1.197
	CNS0095615	Golden flower (tetraploid) 3	0.697
CRA001975	CRR073297	Stem 1	3.060
	CRR073298	Stem 2	3.219
	CRR073299	Stem 3	1.925
	CRR073300	Leaf 1	1.516
	CRR073301	Leaf 2	2.182
	CRR073302	Leaf 3	1.728
	CRR073303	Juvenile bud 1	2.551
	CRR073304	Juvenile bud 2	2.404
	CRR073305	Juvenile bud 3	4.005
	CRR073306	Third green 1	3.284
	CRR073307	Third green 2	2.751
	CRR073308	Third green 3	4.874
	CRR073309	Second white 1	4.087
	CRR073310	Second white 2	8.196
	CRR073311	Second white 3	12.102
	CRR073312	Silver flowering 1	8.688
	CRR073313	Silver flowering 2	2.614
	CRR073314	Silver flowering 3	5.135
	CRR073315	Gold flowering 1	53.199
	CRR073316	Gold flowering 2	43.068
	CRR073317	Gold flowering 3	43.121
	CRR073318	Tawny withering 1	2.474
	CRR073319	Tawny withering 2	1.908
	CRR073320	Tawny withering 3	2.790