Gene detail

Detail information of GWHGAAZE010165

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31310.1	0	NADH-plastoquinone oxidoreductase subunit 7 protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q332S1\|NDHH_LACSA	0	NAD(P)H-quinone oxidoreductase subunit H, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01358}
trEMBL	tr\|D3WBP4\|D3WBP4_LONJA	0	NAD(P)H-quinone oxidoreductase subunit H, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01358}
TAIR10	ATCG01110.1	4E-141	NAD(P)H dehydrogenase subunit H

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123865740	123866513	-
GWHAAZE00000002	mRNA	123865740	123866513	-
GWHAAZE00000002	exon	123865740	123866513	-
GWHAAZE00000002	CDS	123865740	123866513	-

Transcript Sequence
>GWHTAAZE010177 ATGACTACGCCAGTTACAAGAAAAGACCTCATGATAGTCAATATGGGTCCTCACCACCCATCAATGCATGGTGTTCTTCGACTCATTGTTACTCTAGATGGAGAAGATGTTATTGACTGTGAGCCAGTATTGGGTTATTTACATAGAGGTATGGAAAAAATTGCGGAAAACCGAACAATTATACAATATTTGCCTTATGTAACACGTTGGGATTATTTAGCTACTATGTTCACCGAAGCAATAACTGTAAATGCACCGGAGCAGTTAGGCAATATTCAAGTACCTAAAAGGGCCAGCTATATCAGAGTCATTATGCTGGAGTTAAGTCGTATAGCTTCGCATTTGTTATGGCTTGGCCCTTTTATGGCAGATATTGGGGCACAGACCCCTTTCTTCTATATTTTTCGAGAAAGAGAATTGATATATGACCTATTCGAAGCTGCCACCGGTATGCGAATGATGCATAATTTTTTTCGTATCGGAGGGGTAGCTGCTGATTTACCTCATGGATGGATAGATAAATGTTTGGATTTTTGCGATTATTTTTTAACAGAGGTTGCTGAATATCAAAATCTTATTACACGCAATCCTATTTTTTTAAAACGAGTTGAAGGAGTAGGCATTATTGGCGGAAAGGAGGCAATAAATTGGGGTTTATCGGGACCAATGCTACGAGCTTCCGGAATACAATGGGATCTTCGTAAAGTTGATCAGTATGAGTGTTACGACGAGTTCGATTGGGAAGTCCAATGGCAAAATGAGGGGATTCATTAG

Network for GWHGAAZE010165

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00346.20	Complex1_49kDa	124	255	1.30E-54

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05579	ndhH	Metabolic pathways	map01100
K05579	ndhH	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016651	molecular_function	oxidoreductase activity, acting on NAD(P)H
GO:0048038	molecular_function	quinone binding
GO:0051287	molecular_function	NAD binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.184
	SRR3591706	second leaf	4.747
	SRR3591707	mature leaf	3.341
	SRR3591708	Shoot apex	3.769
	SRR3591709	Stem	1.303
	SRR3591710	White floral bud	0.830
	SRR3591711	White flower	0.350
	SRR3591712	Green floral bud	1.073
	SRR3591713	Yellow flower	0.816
SRP173429	SRR8316895	Juvenile bud stage	4.765
	SRR8316896	Juvenile bud stage	2.591
	SRR8316897	Juvenile bud stage	5.941
	SRR8316894	Third green stage	8.170
	SRR8316900	Third green stage	1.768
	SRR8316901	Third green stage	1.290
	SRR8316898	Complete white stage	1.310
	SRR8316899	Complete white stage	1.440
	SRR8316903	Complete white stage	1.624
	SRR8316902	Silver flowering stage	2.351
	SRR8316904	Silver flowering stage	2.510
	SRR8316905	Silver flowering stage	2.167
	SRR8316906	Gold flowering stage	0.873
	SRR8316907	Gold flowering stage	0.989
	SRR8316908	Gold flowering stage	1.377
SRP132670	SRR6706286	Control	0.123
	SRR6706287	Light intensity 50%	0.189
	SRR6706288	Light intensity 20%	0.065
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.536
	CNS0095593	Slightly white alabastrum(diploid) 2	2.292
	CNS0095594	Slightly white alabastrum(diploid) 3	3.232
	CNS0095595	Whole white alabastrum(diploid) 2	5.224
	CNS0095596	Whole white alabastrum(diploid) 3	4.277
	CNS0095597	Whole white alabastrum(diploid) 4	6.183
	CNS0095598	Silvery flower (diploied) 1	3.190
	CNS0095599	Silvery flower (diploied) 2	2.222
	CNS0095600	Silvery flower (diploied) 3	2.245
	CNS0095601	Golden flower (diploid) 1	3.336
	CNS0095602	Golden flower (diploid) 2	2.374
	CNS0095603	Golden flower (diploid) 3	2.702
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.407
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.383
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.886
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.480
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.650
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.296
	CNS0095610	Silvery flower (tetraploid) 1	2.067
	CNS0095611	Silvery flower (tetraploid) 2	2.944
	CNS0095612	Silvery flower (tetraploid) 3	1.224
	CNS0095613	Golden flower (tetraploid) 1	2.934
	CNS0095614	Golden flower (tetraploid) 2	1.997
	CNS0095615	Golden flower (tetraploid) 3	1.372
CRA001975	CRR073297	Stem 1	2.479
	CRR073298	Stem 2	2.371
	CRR073299	Stem 3	0.885
	CRR073300	Leaf 1	1.865
	CRR073301	Leaf 2	1.940
	CRR073302	Leaf 3	0.555
	CRR073303	Juvenile bud 1	0.658
	CRR073304	Juvenile bud 2	1.244
	CRR073305	Juvenile bud 3	1.003
	CRR073306	Third green 1	0.620
	CRR073307	Third green 2	0.336
	CRR073308	Third green 3	0.986
	CRR073309	Second white 1	0.572
	CRR073310	Second white 2	1.214
	CRR073311	Second white 3	1.789
	CRR073312	Silver flowering 1	1.209
	CRR073313	Silver flowering 2	0.430
	CRR073314	Silver flowering 3	0.829
	CRR073315	Gold flowering 1	6.234
	CRR073316	Gold flowering 2	7.758
	CRR073317	Gold flowering 3	3.202
	CRR073318	Tawny withering 1	2.087
	CRR073319	Tawny withering 2	1.598
	CRR073320	Tawny withering 3	1.964