Gene detail

Detail information of GWHGAAZE010110

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091736.1	2.796E-142	NADH dehydrogenase subunit 6 (mitochondrion) [Panax ginseng]
Swissprot	tr\|P60498\|NU6M_BRACM	6E-140	NADH-ubiquinone oxidoreductase chain 6
trEMBL	tr\|A0A096XF97\|A0A096XF97_PANGI	1E-142	NADH dehydrogenase subunit 6 {ECO:0000313\|EMBL:AHJ81019.1}
TAIR10	ATMG00270.1	5E-97	NADH dehydrogenase 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123623233	123623850	-
GWHAAZE00000002	mRNA	123623233	123623850	-
GWHAAZE00000002	exon	123623233	123623850	-
GWHAAZE00000002	CDS	123623233	123623850	-

Transcript Sequence
>GWHTAAZE010122 ATGATACTTTCTGTTTTGTCGAGCCTTGCTTTGGTCTCTGGTTTGATGGTTGTACGTGCTAAAAATCCGGTACATTCCGTTTCGTTTCCCATCCCAGTCTTTCGCAACACTTCAGGTTTACTTCTTTTGTTAGGTCTCGACTTCTTCGCTATGATCTTCCCAGTAGTTCATATAGGAGCTATAGCCGTTTCATTCCTATTCGTTGTTATGATGTTCCATATTCAAATAGCGGAGATTCACGAAGAAGTATTGCGCTATTTACCAGTGAGTGGTATTATTGGACTGATTTTTTGGTGGGAAATGTTCTTCATTTTAGATAATGAAAGCATTCCATTACTACCAACCCAAAGAAATACGACCTCTCTGAGATATATGGTTTATGCCGGAAAGGTACGAAGTTGGACTAATTTGGAAACATTGGGCAATTTACTTTATACCTACTATTTCGTCTGGTTTTTGGTTCCTAGTCTGATTTTATTAGTAGCCATGATTGGGGCTATAGTACTGACTATGCATAGGACTACTAAGGTGAAAAGACAGGATGTATTCCGACGAAATGCTATTGATTCTAGGAGGACTATAATGAGGAGGACGACAGACCCACTCACGATCTACTAA

Network for GWHGAAZE010110

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00499.21	Oxidored_q3	14	169	3.50E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03884	ND6	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.252
	SRR3591707	mature leaf	0.120
	SRR3591708	Shoot apex	0.516
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.070
	SRR3591711	White flower	0.075
	SRR3591712	Green floral bud	0.217
	SRR3591713	Yellow flower	0.150
SRP173429	SRR8316895	Juvenile bud stage	9.865
	SRR8316896	Juvenile bud stage	4.497
	SRR8316897	Juvenile bud stage	19.494
	SRR8316894	Third green stage	22.733
	SRR8316900	Third green stage	1.883
	SRR8316901	Third green stage	1.513
	SRR8316898	Complete white stage	9.350
	SRR8316899	Complete white stage	0.177
	SRR8316903	Complete white stage	10.282
	SRR8316902	Silver flowering stage	16.236
	SRR8316904	Silver flowering stage	16.757
	SRR8316905	Silver flowering stage	14.569
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.057
	SRR8316908	Gold flowering stage	0.172
SRP132670	SRR6706286	Control	0.046
	SRR6706287	Light intensity 50%	0.031
	SRR6706288	Light intensity 20%	0.065
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.934
	CNS0095593	Slightly white alabastrum(diploid) 2	4.211
	CNS0095594	Slightly white alabastrum(diploid) 3	7.458
	CNS0095595	Whole white alabastrum(diploid) 2	6.856
	CNS0095596	Whole white alabastrum(diploid) 3	4.479
	CNS0095597	Whole white alabastrum(diploid) 4	10.673
	CNS0095598	Silvery flower (diploied) 1	7.046
	CNS0095599	Silvery flower (diploied) 2	5.088
	CNS0095600	Silvery flower (diploied) 3	1.398
	CNS0095601	Golden flower (diploid) 1	6.483
	CNS0095602	Golden flower (diploid) 2	1.631
	CNS0095603	Golden flower (diploid) 3	2.836
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.847
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.495
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.390
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.074
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.654
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.285
	CNS0095610	Silvery flower (tetraploid) 1	2.036
	CNS0095611	Silvery flower (tetraploid) 2	1.207
	CNS0095612	Silvery flower (tetraploid) 3	1.038
	CNS0095613	Golden flower (tetraploid) 1	11.078
	CNS0095614	Golden flower (tetraploid) 2	3.856
	CNS0095615	Golden flower (tetraploid) 3	0.942
CRA001975	CRR073297	Stem 1	0.780
	CRR073298	Stem 2	0.634
	CRR073299	Stem 3	0.086
	CRR073300	Leaf 1	0.248
	CRR073301	Leaf 2	0.368
	CRR073302	Leaf 3	0.008
	CRR073303	Juvenile bud 1	0.814
	CRR073304	Juvenile bud 2	0.112
	CRR073305	Juvenile bud 3	1.322
	CRR073306	Third green 1	0.458
	CRR073307	Third green 2	0.319
	CRR073308	Third green 3	0.591
	CRR073309	Second white 1	0.383
	CRR073310	Second white 2	1.597
	CRR073311	Second white 3	6.279
	CRR073312	Silver flowering 1	4.815
	CRR073313	Silver flowering 2	1.618
	CRR073314	Silver flowering 3	3.114
	CRR073315	Gold flowering 1	0.391
	CRR073316	Gold flowering 2	1.304
	CRR073317	Gold flowering 3	2.023
	CRR073318	Tawny withering 1	1.533
	CRR073319	Tawny withering 2	1.155
	CRR073320	Tawny withering 3	0.442