Gene detail

Detail information of GWHGAAZE010096

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADM63437.1	1.7641E-166	photosystem II cp47 protein, partial (chloroplast) [Pentaphragma sp. Duangjai 49]
Swissprot	tr\|Q68RY1\|PSBB_PANGI	5E-165	Photosystem II CP47 reaction center protein {ECO:0000255\|HAMAP-Rule:MF_01495}
trEMBL	tr\|E0XDY5\|E0XDY5_9ASTR	7E-167	Photosystem II cp47 protein {ECO:0000313\|EMBL:ADM63437.1} (Fragment)
TAIR10	ATCG00680.1	2E-131	photosystem II reaction center protein B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123395565	123396320	+
GWHAAZE00000002	mRNA	123395565	123396320	+
GWHAAZE00000002	exon	123395565	123396320	+
GWHAAZE00000002	CDS	123395565	123396320	+

Transcript Sequence
>GWHTAAZE010108 ATGGTTCAGCAACTACTCCGATCGAATTGTTTGGGCCTACTCGTTATCAATGGGATCAGGGGGTACTTTCAGCAAGAGATATACCGAAGGGTTAGTGCTGGACTAGCCGAAAATCAAAGTTTATCAGAAGCTTGGTCTAAAATTCCCGAAAAATTGGCTTTTTATGATTACATCGGCAATAATCCGGCAAAAGGGGGATTATTCAGGGCGGGCTCAATGGATAACGGGGATGGAATAGCCGTTGGATGGTTAGGGCATCCTATCTTTAGAGATAAAGAAGGACGCGAACTTTTTGTACGTCGTATGCCTACTTTTTTTGAAACATTTCCGGTCGTTTTGGTAGACGGCGACGGAATTGTTAGAGCCGATGTTCCTTTTCGAAGGGCCGAATCGAAGTATAGTGTCGAACAAGTAGGTGTAACTGTTGAGTTCTACGGTGGCGAACTCAACGGAGTCAGTTATAGCGATCCTGCTACTGTGAAAAAATATGCTAGACGTGCTCAATTGGGTGAAATTTTTGAGTTAGATCGTGCTACTTTGAAATCCGATGGTGTTTTTCGTAGCAGTCCGAGAGGTTGGTTTACTTTTGGACATGCTTCATTTGCTTTGCTCTTTTTCTTCGGACACATTTGGCATGGTGCTAGAACCTTGTTCAGAGATGTTTTTGCTGGTATTGACCCAGATTTGGATGCTCAAGTAGAATTTGGAGCATTCCAAAAACTTGGAGATCCAACTACAAGAAGACAGGTAGTCTGA

Network for GWHGAAZE010096

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00421.20	PSII	20	243	6.10E-108

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02704	psbB	Metabolic pathways	map01100
K02704	psbB	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009767	biological_process	photosynthetic electron transport chain
GO:0019684	biological_process	photosynthesis, light reaction
GO:0009521	cellular_component	photosystem
GO:0016020	cellular_component	membrane
GO:0016168	molecular_function	chlorophyll binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.082
	SRR3591706	second leaf	2.981
	SRR3591707	mature leaf	4.564
	SRR3591708	Shoot apex	3.496
	SRR3591709	Stem	0.890
	SRR3591710	White floral bud	0.570
	SRR3591711	White flower	0.539
	SRR3591712	Green floral bud	0.525
	SRR3591713	Yellow flower	0.202
SRP173429	SRR8316895	Juvenile bud stage	17.330
	SRR8316896	Juvenile bud stage	5.783
	SRR8316897	Juvenile bud stage	19.351
	SRR8316894	Third green stage	19.777
	SRR8316900	Third green stage	1.172
	SRR8316901	Third green stage	1.394
	SRR8316898	Complete white stage	5.061
	SRR8316899	Complete white stage	0.379
	SRR8316903	Complete white stage	5.660
	SRR8316902	Silver flowering stage	7.328
	SRR8316904	Silver flowering stage	7.319
	SRR8316905	Silver flowering stage	5.441
	SRR8316906	Gold flowering stage	0.623
	SRR8316907	Gold flowering stage	0.395
	SRR8316908	Gold flowering stage	0.235
SRP132670	SRR6706286	Control	0.363
	SRR6706287	Light intensity 50%	0.322
	SRR6706288	Light intensity 20%	0.232
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.926
	CNS0095593	Slightly white alabastrum(diploid) 2	8.234
	CNS0095594	Slightly white alabastrum(diploid) 3	11.251
	CNS0095595	Whole white alabastrum(diploid) 2	13.432
	CNS0095596	Whole white alabastrum(diploid) 3	7.685
	CNS0095597	Whole white alabastrum(diploid) 4	10.432
	CNS0095598	Silvery flower (diploied) 1	9.489
	CNS0095599	Silvery flower (diploied) 2	6.058
	CNS0095600	Silvery flower (diploied) 3	2.468
	CNS0095601	Golden flower (diploid) 1	9.144
	CNS0095602	Golden flower (diploid) 2	2.199
	CNS0095603	Golden flower (diploid) 3	2.844
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.530
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.356
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.081
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.580
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.859
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.773
	CNS0095610	Silvery flower (tetraploid) 1	2.349
	CNS0095611	Silvery flower (tetraploid) 2	2.971
	CNS0095612	Silvery flower (tetraploid) 3	3.495
	CNS0095613	Golden flower (tetraploid) 1	6.732
	CNS0095614	Golden flower (tetraploid) 2	3.890
	CNS0095615	Golden flower (tetraploid) 3	3.884
CRA001975	CRR073297	Stem 1	9.047
	CRR073298	Stem 2	8.485
	CRR073299	Stem 3	5.862
	CRR073300	Leaf 1	4.508
	CRR073301	Leaf 2	5.580
	CRR073302	Leaf 3	3.942
	CRR073303	Juvenile bud 1	6.189
	CRR073304	Juvenile bud 2	3.880
	CRR073305	Juvenile bud 3	11.775
	CRR073306	Third green 1	5.029
	CRR073307	Third green 2	5.048
	CRR073308	Third green 3	5.987
	CRR073309	Second white 1	7.965
	CRR073310	Second white 2	18.844
	CRR073311	Second white 3	27.899
	CRR073312	Silver flowering 1	25.426
	CRR073313	Silver flowering 2	7.128
	CRR073314	Silver flowering 3	10.972
	CRR073315	Gold flowering 1	133.636
	CRR073316	Gold flowering 2	86.245
	CRR073317	Gold flowering 3	130.152
	CRR073318	Tawny withering 1	9.778
	CRR073319	Tawny withering 2	12.409
	CRR073320	Tawny withering 3	8.587