Gene detail

Detail information of GWHGAAZE010050

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091726.1	2.1647E-180	cytochrome c oxidase subunit 3 (mitochondrion) [Panax ginseng]
Swissprot	tr\|P32808\|COX3_HELAN	4E-177	Cytochrome c oxidase subunit 3
trEMBL	tr\|A0A096XF86\|A0A096XF86_PANGI	0	Cytochrome c oxidase subunit 3 {ECO:0000313\|EMBL:AHJ81009.1}
TAIR10	ATMG00730.1	7E-129	cytochrome c oxidase subunit 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122694758	122695552	+
GWHAAZE00000002	mRNA	122694758	122695552	+
GWHAAZE00000002	exon	122694758	122695552	+
GWHAAZE00000002	CDS	122694758	122695552	+

Transcript Sequence
>GWHTAAZE010062 ATGATTGAATCTCAGAGGCATTCTTATCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCGGAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACCCATTTCAAGGGGGCGCAACACTTCTCAGTTTGGGCCTCATCTTTCTCCTATATACCATGTTCGTATGGTGGCGCGATGTTCTACGTGAATCCACGTTGGAAGGACATCATACCAAAGTCGTACAATTAGGACCTCGATATGGTTTTCTTCTGTTTATCGTATCGGAGGTTATGTTCCTTTTTGCTCTTTTTCGGGCTTCTTCTCATTCTTCTTTGGCACCTACGGTAGAGATCGGAGGTATTTGGCCCCAAAGGGATTTTGGTTTTAGATCCTCGGAAATCCCTTTTCTTAATACCCTTATTCCCCCTTCATCCGGAGCTGCCGTAACTTGGGCTCATCATGCTATACTCGCGGGGAAGGAAAAACGAGCAGTTTACGCTTTAGTAGCTACCGTTTCACTGGCTCTAGTATTCACTGGCTTTCAAGGAATGGAATATTATCAAGCACCCTCCACTATTTCGGATAGTATTTATGGTTCTACCTTTTTCTTAGCAACTGGCTTTCATGGTTTTCATGTGATTATAGGTACTCTTTTCTCGATCATATGTGGTATTCGCCAATATCTTGGTCATCTGACCAAGGAGCATCACGTTGGCTTTGAAGCAGCTGCATGGTACTGGCATTTTGTAGACGTGGTTCGGTTATTCCCATTTGTCTCTATCTATTGGTGGGGAGGTATATGA

Network for GWHGAAZE010050

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00510.19	COX3	7	262	6.00E-98

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02262	COX3	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Cardiac muscle contraction	map04260
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0022904	biological_process	respiratory electron transport chain
GO:0016020	cellular_component	membrane
GO:0015002	molecular_function	heme-copper terminal oxidase activity
GO:0004129	molecular_function	cytochrome-c oxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.069
	SRR3591706	second leaf	0.470
	SRR3591707	mature leaf	0.152
	SRR3591708	Shoot apex	1.175
	SRR3591709	Stem	0.278
	SRR3591710	White floral bud	0.326
	SRR3591711	White flower	0.230
	SRR3591712	Green floral bud	0.488
	SRR3591713	Yellow flower	0.322
SRP173429	SRR8316895	Juvenile bud stage	15.221
	SRR8316896	Juvenile bud stage	9.952
	SRR8316897	Juvenile bud stage	24.449
	SRR8316894	Third green stage	28.197
	SRR8316900	Third green stage	4.887
	SRR8316901	Third green stage	1.741
	SRR8316898	Complete white stage	12.258
	SRR8316899	Complete white stage	0.537
	SRR8316903	Complete white stage	13.176
	SRR8316902	Silver flowering stage	16.837
	SRR8316904	Silver flowering stage	17.278
	SRR8316905	Silver flowering stage	18.150
	SRR8316906	Gold flowering stage	0.186
	SRR8316907	Gold flowering stage	0.127
	SRR8316908	Gold flowering stage	0.208
SRP132670	SRR6706286	Control	0.985
	SRR6706287	Light intensity 50%	1.696
	SRR6706288	Light intensity 20%	1.091
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.015
	CNS0095593	Slightly white alabastrum(diploid) 2	6.165
	CNS0095594	Slightly white alabastrum(diploid) 3	9.128
	CNS0095595	Whole white alabastrum(diploid) 2	15.154
	CNS0095596	Whole white alabastrum(diploid) 3	7.389
	CNS0095597	Whole white alabastrum(diploid) 4	17.759
	CNS0095598	Silvery flower (diploied) 1	9.416
	CNS0095599	Silvery flower (diploied) 2	10.912
	CNS0095600	Silvery flower (diploied) 3	3.300
	CNS0095601	Golden flower (diploid) 1	8.933
	CNS0095602	Golden flower (diploid) 2	3.136
	CNS0095603	Golden flower (diploid) 3	5.855
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.299
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.761
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.572
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.758
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.131
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.998
	CNS0095610	Silvery flower (tetraploid) 1	2.437
	CNS0095611	Silvery flower (tetraploid) 2	2.886
	CNS0095612	Silvery flower (tetraploid) 3	0.846
	CNS0095613	Golden flower (tetraploid) 1	12.854
	CNS0095614	Golden flower (tetraploid) 2	4.454
	CNS0095615	Golden flower (tetraploid) 3	1.758
CRA001975	CRR073297	Stem 1	6.149
	CRR073298	Stem 2	4.406
	CRR073299	Stem 3	0.743
	CRR073300	Leaf 1	2.803
	CRR073301	Leaf 2	2.915
	CRR073302	Leaf 3	0.890
	CRR073303	Juvenile bud 1	3.061
	CRR073304	Juvenile bud 2	1.809
	CRR073305	Juvenile bud 3	5.517
	CRR073306	Third green 1	3.874
	CRR073307	Third green 2	1.261
	CRR073308	Third green 3	3.216
	CRR073309	Second white 1	1.376
	CRR073310	Second white 2	6.873
	CRR073311	Second white 3	16.595
	CRR073312	Silver flowering 1	10.322
	CRR073313	Silver flowering 2	2.393
	CRR073314	Silver flowering 3	6.470
	CRR073315	Gold flowering 1	1.696
	CRR073316	Gold flowering 2	1.217
	CRR073317	Gold flowering 3	3.343
	CRR073318	Tawny withering 1	1.857
	CRR073319	Tawny withering 2	3.106
	CRR073320	Tawny withering 3	1.953