Gene detail

Detail information of GWHGAAZE010049

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091731.1	1.4584E-110	ATPase subunit 8 (mitochondrion) [Panax ginseng]
Swissprot	tr\|P41248\|YMF19_HELAN	2E-102	Putative ATP synthase protein YMF19
trEMBL	tr\|A0A096XF91\|A0A096XF91_PANGI	5E-111	ATPase subunit 8 {ECO:0000313\|EMBL:AHJ81014.1}
TAIR10	ATMG00480.1	1E-67	Plant mitochondrial ATPase, F0 complex, subunit 8 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122693664	122694143	+
GWHAAZE00000002	mRNA	122693664	122694143	+
GWHAAZE00000002	exon	122693664	122694143	+
GWHAAZE00000002	CDS	122693664	122694143	+

Transcript Sequence
>GWHTAAZE010061 ATGCCTCAACTGGATAAATTCACTTATTTCACACAATTCTTCTGGTCATGCCTTTTCCTCTTTACTTTCTATATTCCCATATGCAATGATGGAGATGGAGTACTTGGGATCAGCAGAATTCTCAAACTACGGAACCAACTGGTTTCACACCGGGAGAACAACATCCGGAGCAGCGACCCCAACAGTTTGGAAGATATCTTGAGAAAAGGTTTTAGCACCGGTGTCTCCTATATGTACTCCAGTTTATTCGAAGTCTCCCAATGGTGTAACGCCGTCGACTTATTGGGAAAAAGGAGGAAGATCACTTTGATCTCTTGTTTCGGAGAAATAAGTGGCTCACGAGGAATGGAAAGAAACATATTCTATTTGATCTCGAAGTCCTCATATAGCACTTCTTCCAATCCTGGATGGGGGATCACTTGTAGGAATGACATAATGCTAATCCATGTTCCACACGGCCAAGGAAGCATCGGTTTTTAA

Network for GWHGAAZE010049

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02326.16	YMF19	2	81	1.90E-22
PF06449.12	DUF1082	93	143	1.30E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02109	ATPF0B, atpF	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0005739	cellular_component	mitochondrion
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.458
	SRR3591707	mature leaf	0.203
	SRR3591708	Shoot apex	1.665
	SRR3591709	Stem	0.150
	SRR3591710	White floral bud	0.384
	SRR3591711	White flower	0.280
	SRR3591712	Green floral bud	0.813
	SRR3591713	Yellow flower	0.438
SRP173429	SRR8316895	Juvenile bud stage	27.735
	SRR8316896	Juvenile bud stage	22.272
	SRR8316897	Juvenile bud stage	43.790
	SRR8316894	Third green stage	57.144
	SRR8316900	Third green stage	8.060
	SRR8316901	Third green stage	3.251
	SRR8316898	Complete white stage	22.235
	SRR8316899	Complete white stage	0.896
	SRR8316903	Complete white stage	24.698
	SRR8316902	Silver flowering stage	29.230
	SRR8316904	Silver flowering stage	27.981
	SRR8316905	Silver flowering stage	30.573
	SRR8316906	Gold flowering stage	0.075
	SRR8316907	Gold flowering stage	1.342
	SRR8316908	Gold flowering stage	0.922
SRP132670	SRR6706286	Control	1.181
	SRR6706287	Light intensity 50%	1.883
	SRR6706288	Light intensity 20%	1.270
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.687
	CNS0095593	Slightly white alabastrum(diploid) 2	15.343
	CNS0095594	Slightly white alabastrum(diploid) 3	18.086
	CNS0095595	Whole white alabastrum(diploid) 2	21.999
	CNS0095596	Whole white alabastrum(diploid) 3	15.445
	CNS0095597	Whole white alabastrum(diploid) 4	33.491
	CNS0095598	Silvery flower (diploied) 1	12.241
	CNS0095599	Silvery flower (diploied) 2	18.111
	CNS0095600	Silvery flower (diploied) 3	8.633
	CNS0095601	Golden flower (diploid) 1	18.091
	CNS0095602	Golden flower (diploid) 2	4.837
	CNS0095603	Golden flower (diploid) 3	8.278
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.887
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.917
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.870
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.243
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.442
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.186
	CNS0095610	Silvery flower (tetraploid) 1	2.796
	CNS0095611	Silvery flower (tetraploid) 2	5.212
	CNS0095612	Silvery flower (tetraploid) 3	3.725
	CNS0095613	Golden flower (tetraploid) 1	16.617
	CNS0095614	Golden flower (tetraploid) 2	5.125
	CNS0095615	Golden flower (tetraploid) 3	2.820
CRA001975	CRR073297	Stem 1	10.241
	CRR073298	Stem 2	4.878
	CRR073299	Stem 3	1.116
	CRR073300	Leaf 1	2.751
	CRR073301	Leaf 2	3.386
	CRR073302	Leaf 3	1.234
	CRR073303	Juvenile bud 1	3.224
	CRR073304	Juvenile bud 2	2.397
	CRR073305	Juvenile bud 3	11.214
	CRR073306	Third green 1	2.684
	CRR073307	Third green 2	2.724
	CRR073308	Third green 3	4.033
	CRR073309	Second white 1	4.591
	CRR073310	Second white 2	10.441
	CRR073311	Second white 3	26.959
	CRR073312	Silver flowering 1	14.259
	CRR073313	Silver flowering 2	5.576
	CRR073314	Silver flowering 3	12.514
	CRR073315	Gold flowering 1	1.308
	CRR073316	Gold flowering 2	1.693
	CRR073317	Gold flowering 3	2.420
	CRR073318	Tawny withering 1	6.035
	CRR073319	Tawny withering 2	5.430
	CRR073320	Tawny withering 3	1.812