Gene detail

Detail information of GWHGAAZE009677

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004246952.1	9.23868E-95	PREDICTED: NAC domain-containing protein 21/22-like [Solanum lycopersicum]
Swissprot	tr\|Q9S851\|NAC31_ARATH	1E-55	Protein CUP-SHAPED COTYLEDON 3
trEMBL	tr\|K4CSJ2\|K4CSJ2_SOLLC	3E-95	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc09g025310.2.1}
TAIR10	AT4G28530.1	2E-64	NAC domain containing protein 74

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	114856746	114859185	+
GWHAAZE00000002	mRNA	114856746	114859185	+
GWHAAZE00000002	exon	114856746	114856938	+
GWHAAZE00000002	exon	114858866	114859185	+
GWHAAZE00000002	CDS	114856746	114856938	+
GWHAAZE00000002	CDS	114858866	114859185	+

Transcript Sequence
>GWHTAAZE009689 AAAAGAACAAGAGACATTAAAATAATGGGTCTAAGGGACATTGGAGCCACACTTCCTCCAGGGTTTAGATTTTATCCAAGTGACGAGGAGCTGGTTTGCCATTATCTCTACAAAAAGGTTACCAATGAAGACATTCTAAAGGGTACTTTAGTTGAAATTGATCTTCATACATGTGAACCATGGGAGCTTCCTGAGGTGGCAAAGCTAAATTCAACAGAGTGGTACTTCTTCAGCTTTAGAGATAGAAAGTACGCTACCGGGTATCGAGCGAATCGGGCCACCAAGAGCGGGTACTGGAAGGCCACGGGTAAGGATCGGAGTGTGGTGGATCCGAGGAACGGTGGGGTTGTTGGGATGAGGAAGACATTGGTGTTCTACAAAAATAGGGCTCCCAATGGGATTAAAACGGGTTGGATCATGCACGAGTTTCGCCTCGAGAATCCTCACATACCTCCTAAGGTTTGTATTTCTCCTCTCCTCACCACCTTTTATTTCTCATTCATTCATTCTTGA

Network for GWHGAAZE009677

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	19	145	1.70E-38

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.227
	SRR3591706	second leaf	0.268
	SRR3591707	mature leaf	0.444
	SRR3591708	Shoot apex	0.812
	SRR3591709	Stem	21.469
	SRR3591710	White floral bud	3.284
	SRR3591711	White flower	12.329
	SRR3591712	Green floral bud	0.813
	SRR3591713	Yellow flower	14.800
SRP173429	SRR8316895	Juvenile bud stage	0.182
	SRR8316896	Juvenile bud stage	0.219
	SRR8316897	Juvenile bud stage	0.082
	SRR8316894	Third green stage	0.314
	SRR8316900	Third green stage	0.229
	SRR8316901	Third green stage	0.432
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.993
	SRR8316903	Complete white stage	0.616
	SRR8316902	Silver flowering stage	0.173
	SRR8316904	Silver flowering stage	1.976
	SRR8316905	Silver flowering stage	0.299
	SRR8316906	Gold flowering stage	1.207
	SRR8316907	Gold flowering stage	1.450
	SRR8316908	Gold flowering stage	2.097
SRP132670	SRR6706286	Control	0.872
	SRR6706287	Light intensity 50%	0.785
	SRR6706288	Light intensity 20%	0.579
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.300
	CNS0095593	Slightly white alabastrum(diploid) 2	1.070
	CNS0095594	Slightly white alabastrum(diploid) 3	0.668
	CNS0095595	Whole white alabastrum(diploid) 2	0.395
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	1.959
	CNS0095599	Silvery flower (diploied) 2	1.199
	CNS0095600	Silvery flower (diploied) 3	2.926
	CNS0095601	Golden flower (diploid) 1	1.160
	CNS0095602	Golden flower (diploid) 2	6.904
	CNS0095603	Golden flower (diploid) 3	7.425
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.156
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.072
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.212
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.062
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.455
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.202
	CNS0095610	Silvery flower (tetraploid) 1	3.984
	CNS0095611	Silvery flower (tetraploid) 2	2.998
	CNS0095612	Silvery flower (tetraploid) 3	1.691
	CNS0095613	Golden flower (tetraploid) 1	2.687
	CNS0095614	Golden flower (tetraploid) 2	5.516
	CNS0095615	Golden flower (tetraploid) 3	10.829
CRA001975	CRR073297	Stem 1	0.020
	CRR073298	Stem 2	0.248
	CRR073299	Stem 3	1.137
	CRR073300	Leaf 1	0.233
	CRR073301	Leaf 2	0.253
	CRR073302	Leaf 3	0.214
	CRR073303	Juvenile bud 1	0.125
	CRR073304	Juvenile bud 2	0.061
	CRR073305	Juvenile bud 3	0.876
	CRR073306	Third green 1	0.557
	CRR073307	Third green 2	0.914
	CRR073308	Third green 3	1.284
	CRR073309	Second white 1	0.370
	CRR073310	Second white 2	0.249
	CRR073311	Second white 3	1.150
	CRR073312	Silver flowering 1	1.195
	CRR073313	Silver flowering 2	1.365
	CRR073314	Silver flowering 3	0.143
	CRR073315	Gold flowering 1	0.178
	CRR073316	Gold flowering 2	0.614
	CRR073317	Gold flowering 3	0.544
	CRR073318	Tawny withering 1	3.605
	CRR073319	Tawny withering 2	8.310
	CRR073320	Tawny withering 3	1.862