Gene detail

Detail information of GWHGAAZE009672

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010671010.1	6.87221E-16	PREDICTED: casein kinase I isoform X2 [Beta vulgaris subsp. vulgaris]
Swissprot	tr\|P42158\|KC1D_ARATH	1E-11	Casein kinase I isoform delta-like
trEMBL	tr\|K4CW51\|K4CW51_SOLLC	4E-16	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc09g090250.2.1}
TAIR10	AT4G14340.1	4E-15	casein kinase I

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	114765881	114766289	-
GWHAAZE00000002	mRNA	114765881	114766289	-
GWHAAZE00000002	exon	114765881	114765889	-
GWHAAZE00000002	exon	114766058	114766098	-
GWHAAZE00000002	exon	114766214	114766289	-
GWHAAZE00000002	CDS	114766214	114766289	-
GWHAAZE00000002	CDS	114766058	114766098	-
GWHAAZE00000002	CDS	114765881	114765889	-

Transcript Sequence
>GWHTAAZE009684 ATGGATCATGTTGTGGCTGGAAAGTTTAAGCTGGGGAGGAAAATTGGGAGTGGGTCTTTTGGGGAGCTTTATTTAGGTATTAATGTACAAACCGGAGAAGAAGTGGGCATCAAGCTGCATGAATGA

Network for GWHGAAZE009672

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08960	CSNK1E	Wnt signaling pathway	map04310
		Hedgehog signaling pathway	map04340
		Hedgehog signaling pathway - fly	map04341
		Hippo signaling pathway	map04390
		Hippo signaling pathway - fly	map04391
		Hippo signaling pathway - multiple species	map04392
		FoxO signaling pathway	map04068
		Circadian rhythm	map04710
		Circadian rhythm - fly	map04711

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	43.322
	SRR3591706	second leaf	18.161
	SRR3591707	mature leaf	54.976
	SRR3591708	Shoot apex	18.387
	SRR3591709	Stem	36.887
	SRR3591710	White floral bud	35.139
	SRR3591711	White flower	27.746
	SRR3591712	Green floral bud	23.543
	SRR3591713	Yellow flower	30.113
SRP173429	SRR8316895	Juvenile bud stage	12.071
	SRR8316896	Juvenile bud stage	17.427
	SRR8316897	Juvenile bud stage	8.630
	SRR8316894	Third green stage	12.291
	SRR8316900	Third green stage	21.561
	SRR8316901	Third green stage	21.828
	SRR8316898	Complete white stage	11.642
	SRR8316899	Complete white stage	34.142
	SRR8316903	Complete white stage	19.350
	SRR8316902	Silver flowering stage	10.410
	SRR8316904	Silver flowering stage	20.592
	SRR8316905	Silver flowering stage	12.677
	SRR8316906	Gold flowering stage	19.392
	SRR8316907	Gold flowering stage	13.747
	SRR8316908	Gold flowering stage	23.459
SRP132670	SRR6706286	Control	9.665
	SRR6706287	Light intensity 50%	9.300
	SRR6706288	Light intensity 20%	11.881
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.561
	CNS0095593	Slightly white alabastrum(diploid) 2	7.498
	CNS0095594	Slightly white alabastrum(diploid) 3	5.409
	CNS0095595	Whole white alabastrum(diploid) 2	8.445
	CNS0095596	Whole white alabastrum(diploid) 3	6.503
	CNS0095597	Whole white alabastrum(diploid) 4	8.984
	CNS0095598	Silvery flower (diploied) 1	15.547
	CNS0095599	Silvery flower (diploied) 2	9.635
	CNS0095600	Silvery flower (diploied) 3	30.779
	CNS0095601	Golden flower (diploid) 1	9.593
	CNS0095602	Golden flower (diploid) 2	23.268
	CNS0095603	Golden flower (diploid) 3	26.756
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.015
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.979
	CNS0095606	Slightly white alabastrum(tetraploid) 3	35.096
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.693
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.190
	CNS0095609	Whole white alabastrum(tetraploid) 3	35.479
	CNS0095610	Silvery flower (tetraploid) 1	36.872
	CNS0095611	Silvery flower (tetraploid) 2	19.260
	CNS0095612	Silvery flower (tetraploid) 3	18.012
	CNS0095613	Golden flower (tetraploid) 1	18.969
	CNS0095614	Golden flower (tetraploid) 2	38.072
	CNS0095615	Golden flower (tetraploid) 3	23.840
CRA001975	CRR073297	Stem 1	6.479
	CRR073298	Stem 2	4.530
	CRR073299	Stem 3	2.998
	CRR073300	Leaf 1	9.115
	CRR073301	Leaf 2	6.268
	CRR073302	Leaf 3	3.968
	CRR073303	Juvenile bud 1	2.259
	CRR073304	Juvenile bud 2	5.158
	CRR073305	Juvenile bud 3	5.179
	CRR073306	Third green 1	2.696
	CRR073307	Third green 2	4.608
	CRR073308	Third green 3	5.461
	CRR073309	Second white 1	0.401
	CRR073310	Second white 2	3.653
	CRR073311	Second white 3	2.565
	CRR073312	Silver flowering 1	0.186
	CRR073313	Silver flowering 2	0.695
	CRR073314	Silver flowering 3	0.766
	CRR073315	Gold flowering 1	1.376
	CRR073316	Gold flowering 2	2.227
	CRR073317	Gold flowering 3	3.977
	CRR073318	Tawny withering 1	4.886
	CRR073319	Tawny withering 2	2.804
	CRR073320	Tawny withering 3	6.756