Gene detail

Detail information of GWHGAAZE009124

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009595282.1	5.69548E-26	PREDICTED: pyridoxal biosynthesis protein PDX2-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q8LAD0\|PDX2_ARATH	9E-20	Pyridoxal biosynthesis protein PDX2
trEMBL	tr\|W9RH61\|W9RH61_9ROSA	1E-24	Uncharacterized protein {ECO:0000313\|EMBL:EXB74664.1}
TAIR10	AT5G60540.1	2E-16	pyridoxine biosynthesis 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	103023860	103024171	+
GWHAAZE00000002	mRNA	103023860	103024171	+
GWHAAZE00000002	exon	103023860	103023966	+
GWHAAZE00000002	exon	103024042	103024171	+
GWHAAZE00000002	CDS	103023860	103023966	+
GWHAAZE00000002	CDS	103024042	103024171	+

Transcript Sequence
>GWHTAAZE009134 ATGCTTCAGGGGATTTCAGAGTCGGAAAAGAGAGTGATTGTGGCCGTGAAGCAGGGGAATTTGCTAGCAACTGCATTTCACCCTGAATTGACCGCTGACACTCGATGGCACAGTTATTTTTTGAAGATGAGCGAAGACAACACAGGGGCCTCGAGTAGCATATGCATATCCACATCTGAAGAGCATTTAAGCTTCTATGAGCAACCCAGAATCGATCTTCCTGTATTCCAATATTAA

Network for GWHGAAZE009124

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01174.20	SNO	7	44	7.10E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08681	pdxT, pdx2	Vitamin B6 metabolism	map00750

Gene Ontology

GO term	Ontology	Name
GO:0042819	biological_process	vitamin B6 biosynthetic process
GO:0042823	biological_process	pyridoxal phosphate biosynthetic process
GO:0004359	molecular_function	glutaminase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	26.522
	SRR3591706	second leaf	26.703
	SRR3591707	mature leaf	12.645
	SRR3591708	Shoot apex	33.281
	SRR3591709	Stem	15.728
	SRR3591710	White floral bud	31.594
	SRR3591711	White flower	32.727
	SRR3591712	Green floral bud	35.861
	SRR3591713	Yellow flower	27.662
SRP173429	SRR8316895	Juvenile bud stage	27.775
	SRR8316896	Juvenile bud stage	41.901
	SRR8316897	Juvenile bud stage	17.317
	SRR8316894	Third green stage	11.251
	SRR8316900	Third green stage	52.163
	SRR8316901	Third green stage	52.571
	SRR8316898	Complete white stage	19.849
	SRR8316899	Complete white stage	39.019
	SRR8316903	Complete white stage	20.188
	SRR8316902	Silver flowering stage	22.212
	SRR8316904	Silver flowering stage	26.147
	SRR8316905	Silver flowering stage	12.939
	SRR8316906	Gold flowering stage	50.171
	SRR8316907	Gold flowering stage	46.424
	SRR8316908	Gold flowering stage	46.212
SRP132670	SRR6706286	Control	26.231
	SRR6706287	Light intensity 50%	27.462
	SRR6706288	Light intensity 20%	31.750
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	55.627
	CNS0095593	Slightly white alabastrum(diploid) 2	44.269
	CNS0095594	Slightly white alabastrum(diploid) 3	60.060
	CNS0095595	Whole white alabastrum(diploid) 2	50.077
	CNS0095596	Whole white alabastrum(diploid) 3	59.817
	CNS0095597	Whole white alabastrum(diploid) 4	48.369
	CNS0095598	Silvery flower (diploied) 1	24.288
	CNS0095599	Silvery flower (diploied) 2	39.603
	CNS0095600	Silvery flower (diploied) 3	27.466
	CNS0095601	Golden flower (diploid) 1	23.792
	CNS0095602	Golden flower (diploid) 2	20.583
	CNS0095603	Golden flower (diploid) 3	21.237
	CNS0095604	Slightly white alabastrum(tetraploid) 1	44.648
	CNS0095605	Slightly white alabastrum(tetraploid) 2	50.619
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.785
	CNS0095607	Whole white alabastrum(tetraploid) 1	49.006
	CNS0095608	Whole white alabastrum(tetraploid) 2	62.046
	CNS0095609	Whole white alabastrum(tetraploid) 3	44.201
	CNS0095610	Silvery flower (tetraploid) 1	42.065
	CNS0095611	Silvery flower (tetraploid) 2	37.082
	CNS0095612	Silvery flower (tetraploid) 3	52.539
	CNS0095613	Golden flower (tetraploid) 1	27.218
	CNS0095614	Golden flower (tetraploid) 2	30.061
	CNS0095615	Golden flower (tetraploid) 3	13.155
CRA001975	CRR073297	Stem 1	42.799
	CRR073298	Stem 2	43.072
	CRR073299	Stem 3	38.831
	CRR073300	Leaf 1	62.555
	CRR073301	Leaf 2	63.016
	CRR073302	Leaf 3	44.690
	CRR073303	Juvenile bud 1	57.898
	CRR073304	Juvenile bud 2	49.256
	CRR073305	Juvenile bud 3	27.798
	CRR073306	Third green 1	34.099
	CRR073307	Third green 2	33.951
	CRR073308	Third green 3	42.204
	CRR073309	Second white 1	35.253
	CRR073310	Second white 2	40.386
	CRR073311	Second white 3	31.444
	CRR073312	Silver flowering 1	36.155
	CRR073313	Silver flowering 2	27.189
	CRR073314	Silver flowering 3	22.488
	CRR073315	Gold flowering 1	42.739
	CRR073316	Gold flowering 2	48.993
	CRR073317	Gold flowering 3	31.702
	CRR073318	Tawny withering 1	41.926
	CRR073319	Tawny withering 2	57.553
	CRR073320	Tawny withering 3	33.815