Gene detail

Detail information of GWHGAAZE009122

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010098208.1	1.62741E-68	hypothetical protein L484_007670 [Morus notabilis]
Swissprot	tr\|Q8LAD0\|PDX2_ARATH	1E-66	Pyridoxal biosynthesis protein PDX2
trEMBL	tr\|W9RH61\|W9RH61_9ROSA	6E-69	Uncharacterized protein {ECO:0000313\|EMBL:EXB74664.1}
TAIR10	AT5G60540.1	5E-54	pyridoxine biosynthesis 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	103018044	103019852	+
GWHAAZE00000002	mRNA	103018044	103019852	+
GWHAAZE00000002	exon	103018044	103018095	+
GWHAAZE00000002	exon	103018195	103018322	+
GWHAAZE00000002	exon	103019317	103019404	+
GWHAAZE00000002	exon	103019752	103019852	+
GWHAAZE00000002	CDS	103018044	103018095	+
GWHAAZE00000002	CDS	103018195	103018322	+
GWHAAZE00000002	CDS	103019317	103019404	+
GWHAAZE00000002	CDS	103019752	103019852	+

Transcript Sequence
>GWHTAAZE009132 ATGGCAGTGGGCGTCCTCGCCTTACAGGGATCTTTCAACGAACACATTGCTGTGCTTAGAAGATTAGGAGTGAAGGGCGTAGAGATAAGGAAGCCTGAACACCTCAATTATGTCACTTCCCTCATTATTCCCGGAGGGGAGAGCACCACCATGGCCAAGCTCGCAGAGTACCATAATCTGTTTCCTGCTTTGCGTGAATTTGTTAGAATGGGCAGGCCTGTTTGGGGAACATGTGCCGGCCTTATCTTCTTGGCAAACAATGCAACAGGCAAGAAAACAGGAGGGCAGGAACTGATTGGGGGCCTTGATTGTACTGTCCAACGGAACTTCTTTGGAAGTCAGGTATTTCTAAGTGTGTTGTGTCGATGA

Network for GWHGAAZE009122

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01174.20	SNO	5	115	2.80E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08681	pdxT, pdx2	Vitamin B6 metabolism	map00750

Gene Ontology

GO term	Ontology	Name
GO:0042819	biological_process	vitamin B6 biosynthetic process
GO:0042823	biological_process	pyridoxal phosphate biosynthetic process
GO:0004359	molecular_function	glutaminase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.230
	SRR3591706	second leaf	23.518
	SRR3591707	mature leaf	10.944
	SRR3591708	Shoot apex	23.744
	SRR3591709	Stem	13.877
	SRR3591710	White floral bud	33.973
	SRR3591711	White flower	29.895
	SRR3591712	Green floral bud	30.424
	SRR3591713	Yellow flower	22.775
SRP173429	SRR8316895	Juvenile bud stage	20.322
	SRR8316896	Juvenile bud stage	24.304
	SRR8316897	Juvenile bud stage	10.231
	SRR8316894	Third green stage	10.447
	SRR8316900	Third green stage	36.230
	SRR8316901	Third green stage	34.488
	SRR8316898	Complete white stage	14.185
	SRR8316899	Complete white stage	26.739
	SRR8316903	Complete white stage	13.599
	SRR8316902	Silver flowering stage	17.492
	SRR8316904	Silver flowering stage	16.582
	SRR8316905	Silver flowering stage	10.299
	SRR8316906	Gold flowering stage	40.206
	SRR8316907	Gold flowering stage	32.702
	SRR8316908	Gold flowering stage	32.831
SRP132670	SRR6706286	Control	63.626
	SRR6706287	Light intensity 50%	64.415
	SRR6706288	Light intensity 20%	72.757
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.165
	CNS0095593	Slightly white alabastrum(diploid) 2	27.360
	CNS0095594	Slightly white alabastrum(diploid) 3	25.259
	CNS0095595	Whole white alabastrum(diploid) 2	31.539
	CNS0095596	Whole white alabastrum(diploid) 3	30.234
	CNS0095597	Whole white alabastrum(diploid) 4	29.178
	CNS0095598	Silvery flower (diploied) 1	17.108
	CNS0095599	Silvery flower (diploied) 2	20.200
	CNS0095600	Silvery flower (diploied) 3	21.830
	CNS0095601	Golden flower (diploid) 1	23.426
	CNS0095602	Golden flower (diploid) 2	16.619
	CNS0095603	Golden flower (diploid) 3	15.137
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.162
	CNS0095605	Slightly white alabastrum(tetraploid) 2	25.901
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.247
	CNS0095607	Whole white alabastrum(tetraploid) 1	28.781
	CNS0095608	Whole white alabastrum(tetraploid) 2	32.315
	CNS0095609	Whole white alabastrum(tetraploid) 3	37.259
	CNS0095610	Silvery flower (tetraploid) 1	30.184
	CNS0095611	Silvery flower (tetraploid) 2	31.543
	CNS0095612	Silvery flower (tetraploid) 3	43.230
	CNS0095613	Golden flower (tetraploid) 1	18.294
	CNS0095614	Golden flower (tetraploid) 2	21.974
	CNS0095615	Golden flower (tetraploid) 3	11.785
CRA001975	CRR073297	Stem 1	40.164
	CRR073298	Stem 2	33.785
	CRR073299	Stem 3	33.887
	CRR073300	Leaf 1	52.213
	CRR073301	Leaf 2	51.665
	CRR073302	Leaf 3	45.957
	CRR073303	Juvenile bud 1	44.168
	CRR073304	Juvenile bud 2	40.436
	CRR073305	Juvenile bud 3	18.016
	CRR073306	Third green 1	36.586
	CRR073307	Third green 2	31.495
	CRR073308	Third green 3	42.087
	CRR073309	Second white 1	33.017
	CRR073310	Second white 2	26.307
	CRR073311	Second white 3	22.433
	CRR073312	Silver flowering 1	27.823
	CRR073313	Silver flowering 2	22.345
	CRR073314	Silver flowering 3	14.335
	CRR073315	Gold flowering 1	42.780
	CRR073316	Gold flowering 2	40.059
	CRR073317	Gold flowering 3	21.062
	CRR073318	Tawny withering 1	35.125
	CRR073319	Tawny withering 2	21.676
	CRR073320	Tawny withering 3	16.483