Gene detail

Detail information of GWHGAAZE008190

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EPS67183.1	6.1365E-24	peroxidase, partial [Genlisea aurea]
Swissprot	tr\|A7NY33\|PER4_VITVI	1E-23	Peroxidase 4 {ECO:0000250\|UniProtKB:Q42578} (Precursor)
trEMBL	tr\|S8DVG5\|S8DVG5_9LAMI	2E-24	Peroxidase {ECO:0000313\|EMBL:EPS67183.1} (Fragment)
TAIR10	AT5G58400.1	2E-18	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	64679792	64680061	-
GWHAAZE00000002	mRNA	64679792	64680061	-
GWHAAZE00000002	exon	64679792	64680061	-
GWHAAZE00000002	CDS	64679792	64680061	-

Transcript Sequence
>GWHTAAZE008198 ATGTGGGGCTTATCTTTGCCGGGTGCACATACAATTGGCCAAGCACGATGCTCTACATTTCGTGCTCGCATATCCAACGACACGAACATCGATAAAGAGTTCGCAAGGGCCTTGAGATCTGCATGTAATACTAATGATGAAAATGTAGCTGCTCCGAGTGCATCAAGCCCAGAGAAATTTGATAATGGCTACTACAAGGGTTTGATGGCCCACTGTGGCCTTCTCCATTCAAACCAGAAACTTTATAATGGGGTCCATTGGATGAATTAG

Network for GWHGAAZE008190

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	6	83	1.10E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.345
	SRR3591706	second leaf	1.262
	SRR3591707	mature leaf	0.606
	SRR3591708	Shoot apex	2.092
	SRR3591709	Stem	1.821
	SRR3591710	White floral bud	1.705
	SRR3591711	White flower	1.367
	SRR3591712	Green floral bud	5.387
	SRR3591713	Yellow flower	0.845
SRP173429	SRR8316895	Juvenile bud stage	3.331
	SRR8316896	Juvenile bud stage	8.969
	SRR8316897	Juvenile bud stage	8.007
	SRR8316894	Third green stage	3.071
	SRR8316900	Third green stage	7.677
	SRR8316901	Third green stage	8.736
	SRR8316898	Complete white stage	2.829
	SRR8316899	Complete white stage	7.389
	SRR8316903	Complete white stage	6.778
	SRR8316902	Silver flowering stage	4.939
	SRR8316904	Silver flowering stage	3.016
	SRR8316905	Silver flowering stage	1.693
	SRR8316906	Gold flowering stage	3.744
	SRR8316907	Gold flowering stage	6.705
	SRR8316908	Gold flowering stage	9.065
SRP132670	SRR6706286	Control	2.169
	SRR6706287	Light intensity 50%	1.220
	SRR6706288	Light intensity 20%	0.727
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.149
	CNS0095593	Slightly white alabastrum(diploid) 2	19.930
	CNS0095594	Slightly white alabastrum(diploid) 3	23.702
	CNS0095595	Whole white alabastrum(diploid) 2	15.187
	CNS0095596	Whole white alabastrum(diploid) 3	21.074
	CNS0095597	Whole white alabastrum(diploid) 4	18.520
	CNS0095598	Silvery flower (diploied) 1	17.322
	CNS0095599	Silvery flower (diploied) 2	16.939
	CNS0095600	Silvery flower (diploied) 3	8.467
	CNS0095601	Golden flower (diploid) 1	15.747
	CNS0095602	Golden flower (diploid) 2	6.608
	CNS0095603	Golden flower (diploid) 3	5.802
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.411
	CRR073298	Stem 2	1.517
	CRR073299	Stem 3	0.623
	CRR073300	Leaf 1	0.920
	CRR073301	Leaf 2	2.470
	CRR073302	Leaf 3	0.770
	CRR073303	Juvenile bud 1	1.059
	CRR073304	Juvenile bud 2	0.916
	CRR073305	Juvenile bud 3	0.355
	CRR073306	Third green 1	0.995
	CRR073307	Third green 2	1.793
	CRR073308	Third green 3	0.804
	CRR073309	Second white 1	0.147
	CRR073310	Second white 2	0.624
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.152
	CRR073313	Silver flowering 2	0.389
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.103
	CRR073316	Gold flowering 2	2.080
	CRR073317	Gold flowering 3	0.782
	CRR073318	Tawny withering 1	0.947
	CRR073319	Tawny withering 2	3.548
	CRR073320	Tawny withering 3	2.406