Gene detail

Detail information of GWHGAAZE008189

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008782624.1	7.71277E-71	PREDICTED: peroxidase 4-like [Phoenix dactylifera]
Swissprot	tr\|A7NY33\|PER4_VITVI	2E-68	Peroxidase 4 {ECO:0000250\|UniProtKB:Q42578} (Precursor)
trEMBL	tr\|Q9SSZ7\|Q9SSZ7_SCUBA	1E-70	Peroxidase 3 {ECO:0000313\|EMBL:BAA77389.1}
TAIR10	AT5G05340.1	5E-55	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	64648389	64649236	+
GWHAAZE00000002	mRNA	64648389	64649236	+
GWHAAZE00000002	exon	64648389	64648439	+
GWHAAZE00000002	exon	64648691	64649236	+
GWHAAZE00000002	CDS	64648389	64648439	+
GWHAAZE00000002	CDS	64648691	64649236	+

Transcript Sequence
>GWHTAAZE008197 ATGATAGAATCGTCTTGCGAAGGCATTGTGTCTTGTACTGATGTACTGGCTCTTGGTGGCCCGTCTTATGAAGTGGTGCTAGGAAGGAGGGATGGTAGGAGTACAAGTTTAGCTGCAGTCAGTGGGCAGCTGCCAGGTCCCTCCTTCAACGTGTCTCAGTTGATTTCTGCGTTTGGTTCCAAGGGTTTTACTGCTGAAGAGATGGTTGTGCTCTCGGGTGCACATACGATTGGCCAAGCTCGATGCTCTACATTTCGTGCTCGCATATCCAATGACACGAACAGCCATAAAGAGTTCGCAAGGGCTTTGAGATCTGCGTGTAATACTAATGATGAAAATTTAGCTGCTATGAGTGCATCAAGCCCAGAGAAATTTGACAATGACTACTACAGGGGTTTGATGGCCCACCGTGGCCTTTTGCACTCAGACCAGGAACTTTATAATGGGGGTCAATTGGATGAATTGGTCCTCTTATACGCAATGAATGAGACTTTGTTTGAAATGGATTTTGTTGCCGCGATGACGAAGATGGGTGAGTTAAGACCTTCCACCGGTGAGGAAGGGGAGGTGAGAAGACAATGTTCAAGAATAAATTGA

Network for GWHGAAZE008189

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	2	161	3.30E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.699
	SRR3591706	second leaf	0.917
	SRR3591707	mature leaf	2.422
	SRR3591708	Shoot apex	5.287
	SRR3591709	Stem	4.187
	SRR3591710	White floral bud	6.096
	SRR3591711	White flower	1.879
	SRR3591712	Green floral bud	16.631
	SRR3591713	Yellow flower	1.181
SRP173429	SRR8316895	Juvenile bud stage	17.616
	SRR8316896	Juvenile bud stage	14.789
	SRR8316897	Juvenile bud stage	7.402
	SRR8316894	Third green stage	6.942
	SRR8316900	Third green stage	21.271
	SRR8316901	Third green stage	25.670
	SRR8316898	Complete white stage	5.906
	SRR8316899	Complete white stage	15.239
	SRR8316903	Complete white stage	8.155
	SRR8316902	Silver flowering stage	4.946
	SRR8316904	Silver flowering stage	3.750
	SRR8316905	Silver flowering stage	1.077
	SRR8316906	Gold flowering stage	2.381
	SRR8316907	Gold flowering stage	2.097
	SRR8316908	Gold flowering stage	8.853
SRP132670	SRR6706286	Control	31.425
	SRR6706287	Light intensity 50%	36.030
	SRR6706288	Light intensity 20%	39.272
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.094
	CNS0095593	Slightly white alabastrum(diploid) 2	30.032
	CNS0095594	Slightly white alabastrum(diploid) 3	41.823
	CNS0095595	Whole white alabastrum(diploid) 2	36.107
	CNS0095596	Whole white alabastrum(diploid) 3	36.986
	CNS0095597	Whole white alabastrum(diploid) 4	51.275
	CNS0095598	Silvery flower (diploied) 1	7.122
	CNS0095599	Silvery flower (diploied) 2	5.488
	CNS0095600	Silvery flower (diploied) 3	4.745
	CNS0095601	Golden flower (diploid) 1	10.380
	CNS0095602	Golden flower (diploid) 2	4.545
	CNS0095603	Golden flower (diploid) 3	3.132
	CNS0095604	Slightly white alabastrum(tetraploid) 1	22.136
	CNS0095605	Slightly white alabastrum(tetraploid) 2	26.312
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.829
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.285
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.342
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.081
	CNS0095610	Silvery flower (tetraploid) 1	7.291
	CNS0095611	Silvery flower (tetraploid) 2	5.562
	CNS0095612	Silvery flower (tetraploid) 3	4.614
	CNS0095613	Golden flower (tetraploid) 1	1.362
	CNS0095614	Golden flower (tetraploid) 2	5.427
	CNS0095615	Golden flower (tetraploid) 3	1.238
CRA001975	CRR073297	Stem 1	12.596
	CRR073298	Stem 2	10.779
	CRR073299	Stem 3	11.759
	CRR073300	Leaf 1	7.856
	CRR073301	Leaf 2	9.095
	CRR073302	Leaf 3	10.886
	CRR073303	Juvenile bud 1	13.993
	CRR073304	Juvenile bud 2	10.140
	CRR073305	Juvenile bud 3	9.342
	CRR073306	Third green 1	15.197
	CRR073307	Third green 2	15.231
	CRR073308	Third green 3	14.128
	CRR073309	Second white 1	0.748
	CRR073310	Second white 2	1.442
	CRR073311	Second white 3	1.090
	CRR073312	Silver flowering 1	0.504
	CRR073313	Silver flowering 2	0.203
	CRR073314	Silver flowering 3	0.125
	CRR073315	Gold flowering 1	27.574
	CRR073316	Gold flowering 2	27.961
	CRR073317	Gold flowering 3	15.004
	CRR073318	Tawny withering 1	15.479
	CRR073319	Tawny withering 2	16.454
	CRR073320	Tawny withering 3	25.719