Gene detail

Detail information of GWHGAAZE007545

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010912058.1	1.10775E-87	PREDICTED: V-type proton ATPase 16 kDa proteolipid subunit-like isoform X2 [Elaeis guineensis]
Swissprot	tr\|Q96473\|VATL_KALDA	6E-90	V-type proton ATPase 16 kDa proteolipid subunit
trEMBL	tr\|I1JSI4\|I1JSI4_SOYBN	4E-88	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA04G00950.2}
TAIR10	AT1G19910.1	2E-51	ATPase, F0/V0 complex, subunit C protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	47308228	47317597	-
GWHAAZE00000002	mRNA	47308228	47317597	-
GWHAAZE00000002	exon	47317314	47317597	-
GWHAAZE00000002	exon	47308228	47308360	-
GWHAAZE00000002	CDS	47317314	47317597	-
GWHAAZE00000002	CDS	47308228	47308360	-

Transcript Sequence
>GWHTAAZE007553 ATGGGAGCAGCGTATGGGACGGCAAAGAGCGGAGTTGGTGTGGCTTCGATGGGAGTAATGAGGCCGGAGCTGGTTATGAAGTCAATTGTGCCTGTAGTTATGGCCGGTGTTTTAGGTATTTACGGTTTGATTATTGCTGTGATAATTAGTACTGGAATTAACCCCAAGGCCAAATCTTATTACCTTTTTGATGGTTACGCACACCTCTCGTCTGGACTCGCTTGTGGTCTGGCTGGGCTTTCGGCTGGAATGGCCATCGGAATTGTTGGCGATGCTGGTGTTAGAGCAAATGCACAACAGCCAAAGCTTTTTGTTGGAATGATTCTTATTCTCATCTTTGCTGAGGCGTTGGCTCTTTATGGTCTCATTGTTGGCATTATCCTTTCGTCGCGAGCTGGCCAATCCCGAGTTGATTAG

Network for GWHGAAZE007545

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	1	49	1.60E-10
PF00137.22	ATP-synt_C	70	128	1.70E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.273
	SRR3591706	second leaf	1.552
	SRR3591707	mature leaf	2.115
	SRR3591708	Shoot apex	0.173
	SRR3591709	Stem	1.940
	SRR3591710	White floral bud	18.884
	SRR3591711	White flower	4.313
	SRR3591712	Green floral bud	31.994
	SRR3591713	Yellow flower	0.432
SRP173429	SRR8316895	Juvenile bud stage	0.511
	SRR8316896	Juvenile bud stage	1.364
	SRR8316897	Juvenile bud stage	2.213
	SRR8316894	Third green stage	2.528
	SRR8316900	Third green stage	12.107
	SRR8316901	Third green stage	12.853
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.474
	SRR8316903	Complete white stage	0.123
	SRR8316902	Silver flowering stage	0.408
	SRR8316904	Silver flowering stage	0.206
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.314
	SRR8316907	Gold flowering stage	0.129
	SRR8316908	Gold flowering stage	0.066
SRP132670	SRR6706286	Control	3.732
	SRR6706287	Light intensity 50%	4.675
	SRR6706288	Light intensity 20%	4.657
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.302
	CNS0095593	Slightly white alabastrum(diploid) 2	4.398
	CNS0095594	Slightly white alabastrum(diploid) 3	7.773
	CNS0095595	Whole white alabastrum(diploid) 2	30.139
	CNS0095596	Whole white alabastrum(diploid) 3	29.341
	CNS0095597	Whole white alabastrum(diploid) 4	38.336
	CNS0095598	Silvery flower (diploied) 1	0.908
	CNS0095599	Silvery flower (diploied) 2	2.843
	CNS0095600	Silvery flower (diploied) 3	0.227
	CNS0095601	Golden flower (diploid) 1	1.924
	CNS0095602	Golden flower (diploid) 2	0.441
	CNS0095603	Golden flower (diploid) 3	1.035
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.198
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.628
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.238
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.318
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.380
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.312
	CNS0095612	Silvery flower (tetraploid) 3	1.701
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	1.993
CRA001975	CRR073297	Stem 1	0.166
	CRR073298	Stem 2	1.985
	CRR073299	Stem 3	0.272
	CRR073300	Leaf 1	9.193
	CRR073301	Leaf 2	6.534
	CRR073302	Leaf 3	4.588
	CRR073303	Juvenile bud 1	9.656
	CRR073304	Juvenile bud 2	7.951
	CRR073305	Juvenile bud 3	0.147
	CRR073306	Third green 1	1.503
	CRR073307	Third green 2	3.773
	CRR073308	Third green 3	2.963
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.600
	CRR073311	Second white 3	0.361
	CRR073312	Silver flowering 1	1.035
	CRR073313	Silver flowering 2	2.642
	CRR073314	Silver flowering 3	1.007
	CRR073315	Gold flowering 1	4.227
	CRR073316	Gold flowering 2	1.526
	CRR073317	Gold flowering 3	2.530
	CRR073318	Tawny withering 1	1.367
	CRR073319	Tawny withering 2	3.133
	CRR073320	Tawny withering 3	1.440