Gene detail

Detail information of GWHGAAZE007278

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABI93942.1	1.15727E-63	syntaxin [Nicotiana benthamiana]
Swissprot	tr\|Q9SRV7\|SY131_ARATH	9E-49	Putative syntaxin-131
trEMBL	tr\|A0F0A7\|A0F0A7_NICBE	4E-64	Syntaxin {ECO:0000313\|EMBL:ABI93942.1} (Fragment)
TAIR10	AT3G03800.1	1E-40	syntaxin of plants 131

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	41877348	41880900	+
GWHAAZE00000002	mRNA	41877348	41880900	+
GWHAAZE00000002	exon	41877348	41877359	+
GWHAAZE00000002	exon	41877518	41877625	+
GWHAAZE00000002	exon	41877824	41877880	+
GWHAAZE00000002	exon	41879159	41879207	+
GWHAAZE00000002	exon	41880645	41880733	+
GWHAAZE00000002	exon	41880823	41880900	+
GWHAAZE00000002	CDS	41877348	41877359	+
GWHAAZE00000002	CDS	41877518	41877625	+
GWHAAZE00000002	CDS	41877824	41877880	+
GWHAAZE00000002	CDS	41879159	41879207	+
GWHAAZE00000002	CDS	41880645	41880733	+
GWHAAZE00000002	CDS	41880823	41880900	+

Transcript Sequence
>GWHTAAZE007286 ATGAGCCTCGAGGATTCGGAGATCCCTAGGGGTCAAGCTTATAGAGATGGAGACATTGAAATGGGAACACAACGTCAACCAAATTCAGGAGAATTAGGCTTGGACGCTTTCTTTAAGCAGGTTCAAGGAATTGATAAACAATATGAGAAGCTGAATAAGCTACTAAAAAAGCTACAGGATGCTCATGAGGAATCGAGAGCTGTAACCAAGGCTGCTTCTATGAAAGCAATCAAGCAGCGAATGGAGAAAGATGTTGATGAAGTTGGAAAAATTGCTCGTTTAATTAAATCAAAAATTGAGGAACTTGACAAAGATAATTTTACCAGTAGGCAGAAGCCTGGATGCGGAAAAGGAACGGGTGTTGACCGATCAAGAACAGCAACAACAGTGTAA

Network for GWHGAAZE007278

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00804.26	Syntaxin	34	129	1.50E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08486	STX1B_2_3	SNARE interactions in vesicular transport	map04130
K08486	STX1B_2_3	Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	57.067
	SRR3591706	second leaf	13.529
	SRR3591707	mature leaf	6.140
	SRR3591708	Shoot apex	25.521
	SRR3591709	Stem	22.633
	SRR3591710	White floral bud	12.603
	SRR3591711	White flower	11.066
	SRR3591712	Green floral bud	17.810
	SRR3591713	Yellow flower	7.853
SRP173429	SRR8316895	Juvenile bud stage	17.448
	SRR8316896	Juvenile bud stage	26.199
	SRR8316897	Juvenile bud stage	14.400
	SRR8316894	Third green stage	13.316
	SRR8316900	Third green stage	28.854
	SRR8316901	Third green stage	25.015
	SRR8316898	Complete white stage	15.659
	SRR8316899	Complete white stage	30.496
	SRR8316903	Complete white stage	20.930
	SRR8316902	Silver flowering stage	9.951
	SRR8316904	Silver flowering stage	16.312
	SRR8316905	Silver flowering stage	9.542
	SRR8316906	Gold flowering stage	26.228
	SRR8316907	Gold flowering stage	20.783
	SRR8316908	Gold flowering stage	24.465
SRP132670	SRR6706286	Control	26.962
	SRR6706287	Light intensity 50%	29.726
	SRR6706288	Light intensity 20%	30.463
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.196
	CNS0095593	Slightly white alabastrum(diploid) 2	21.878
	CNS0095594	Slightly white alabastrum(diploid) 3	16.649
	CNS0095595	Whole white alabastrum(diploid) 2	19.202
	CNS0095596	Whole white alabastrum(diploid) 3	16.202
	CNS0095597	Whole white alabastrum(diploid) 4	18.683
	CNS0095598	Silvery flower (diploied) 1	13.937
	CNS0095599	Silvery flower (diploied) 2	7.572
	CNS0095600	Silvery flower (diploied) 3	15.323
	CNS0095601	Golden flower (diploid) 1	8.807
	CNS0095602	Golden flower (diploid) 2	13.852
	CNS0095603	Golden flower (diploid) 3	15.070
	CNS0095604	Slightly white alabastrum(tetraploid) 1	26.635
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.305
	CNS0095606	Slightly white alabastrum(tetraploid) 3	41.698
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.411
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.330
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.686
	CNS0095610	Silvery flower (tetraploid) 1	25.353
	CNS0095611	Silvery flower (tetraploid) 2	22.792
	CNS0095612	Silvery flower (tetraploid) 3	23.032
	CNS0095613	Golden flower (tetraploid) 1	19.050
	CNS0095614	Golden flower (tetraploid) 2	22.341
	CNS0095615	Golden flower (tetraploid) 3	14.977
CRA001975	CRR073297	Stem 1	24.058
	CRR073298	Stem 2	20.626
	CRR073299	Stem 3	18.090
	CRR073300	Leaf 1	28.342
	CRR073301	Leaf 2	28.102
	CRR073302	Leaf 3	26.875
	CRR073303	Juvenile bud 1	29.517
	CRR073304	Juvenile bud 2	33.319
	CRR073305	Juvenile bud 3	22.654
	CRR073306	Third green 1	39.835
	CRR073307	Third green 2	33.634
	CRR073308	Third green 3	37.554
	CRR073309	Second white 1	10.300
	CRR073310	Second white 2	15.392
	CRR073311	Second white 3	9.647
	CRR073312	Silver flowering 1	9.182
	CRR073313	Silver flowering 2	7.953
	CRR073314	Silver flowering 3	2.536
	CRR073315	Gold flowering 1	13.157
	CRR073316	Gold flowering 2	12.308
	CRR073317	Gold flowering 3	9.159
	CRR073318	Tawny withering 1	30.963
	CRR073319	Tawny withering 2	26.751
	CRR073320	Tawny withering 3	40.369