Gene detail

Detail information of GWHGAAZE007007

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004238356.1	2.8055E-89	PREDICTED: mediator of RNA polymerase II transcription subunit 7a [Solanum lycopersicum]
Swissprot	tr\|Q9LZD7\|MED7B_ARATH	8E-80	Mediator of RNA polymerase II transcription subunit 7b
trEMBL	tr\|K4BVM2\|K4BVM2_SOLLC	1E-89	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc04g081430.2.1}
TAIR10	AT5G03220.1	6E-60	Mediator complex, subunit Med7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	36030393	36037328	+
GWHAAZE00000002	mRNA	36030393	36037328	+
GWHAAZE00000002	exon	36030393	36030509	+
GWHAAZE00000002	exon	36032132	36032297	+
GWHAAZE00000002	exon	36035158	36035227	+
GWHAAZE00000002	exon	36036943	36037109	+
GWHAAZE00000002	exon	36037227	36037328	+
GWHAAZE00000002	five_prime_UTR	36030393	36030509	+
GWHAAZE00000002	five_prime_UTR	36032132	36032162	+
GWHAAZE00000002	CDS	36032163	36032297	+
GWHAAZE00000002	CDS	36035158	36035227	+
GWHAAZE00000002	CDS	36036943	36037109	+
GWHAAZE00000002	CDS	36037227	36037328	+

Transcript Sequence
>GWHTAAZE007015 CCTCCCACGCAAATTGCCGGCCTCCCTCTCATTGTCCCTCTTCAACGTTGACCTCCCTCATCCGGCACCGCCCGTCGCCACCTCCAAAGCCCTAATTTTCTCTTTTTGGTCTCGAAGGTTTTTGGACTGTTAGAGAAAAGAGTTTGTAATGGCGACAGCTACGTACCCACCTCCTCCACCATATTACAGGCTTTACAAGGATTACATCGAAAACCCTAAGTCAGCTCCAGAGCCTCCCCCTCCGATTGAAGGCACCTACGTCCTCTATGGTGCTAACTACACTACTGATGATGCGTTACCGACTTTGGAGGATCAGGGTGTTCGTCAATTGTACCCAAAAGGACCTGATATTGATTTTAAGAAGGAATTGAGGTCGCTTAACAGAGAATTACAGCTACATATTTTGGAGCTTGCTGATGTTCTTATAGAGCGGCCATCGCAATATGCCAGGAGGGTCGAAGACATATCTCTTATATTTAAAAATTTACATCACCTTCTCAATTCGTTGCGTCCCCATCAGGCGAGAGCGACACTGATTCACATACTCGAACTTCAGATACAACGCCGTAAACAGGCCGTGGAGGACATCAAGAGGTATGTAATCTTCGAAAAGATGATTTAG

Network for GWHGAAZE007007

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05983.12	Med7	4	149	1.00E-40

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MED7

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006357	biological_process	regulation of transcription by RNA polymerase II
GO:0016592	cellular_component	mediator complex
GO:0003712	molecular_function	transcription coregulator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.466
	SRR3591706	second leaf	8.103
	SRR3591707	mature leaf	7.695
	SRR3591708	Shoot apex	16.645
	SRR3591709	Stem	12.977
	SRR3591710	White floral bud	13.831
	SRR3591711	White flower	18.611
	SRR3591712	Green floral bud	18.925
	SRR3591713	Yellow flower	17.584
SRP173429	SRR8316895	Juvenile bud stage	14.517
	SRR8316896	Juvenile bud stage	25.261
	SRR8316897	Juvenile bud stage	13.460
	SRR8316894	Third green stage	9.449
	SRR8316900	Third green stage	24.910
	SRR8316901	Third green stage	25.916
	SRR8316898	Complete white stage	7.433
	SRR8316899	Complete white stage	25.558
	SRR8316903	Complete white stage	11.353
	SRR8316902	Silver flowering stage	10.481
	SRR8316904	Silver flowering stage	12.550
	SRR8316905	Silver flowering stage	6.344
	SRR8316906	Gold flowering stage	23.343
	SRR8316907	Gold flowering stage	22.741
	SRR8316908	Gold flowering stage	23.666
SRP132670	SRR6706286	Control	23.001
	SRR6706287	Light intensity 50%	22.804
	SRR6706288	Light intensity 20%	22.926
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	24.865
	CNS0095593	Slightly white alabastrum(diploid) 2	26.966
	CNS0095594	Slightly white alabastrum(diploid) 3	29.943
	CNS0095595	Whole white alabastrum(diploid) 2	23.490
	CNS0095596	Whole white alabastrum(diploid) 3	23.958
	CNS0095597	Whole white alabastrum(diploid) 4	24.462
	CNS0095598	Silvery flower (diploied) 1	19.261
	CNS0095599	Silvery flower (diploied) 2	19.752
	CNS0095600	Silvery flower (diploied) 3	16.098
	CNS0095601	Golden flower (diploid) 1	16.211
	CNS0095602	Golden flower (diploid) 2	20.587
	CNS0095603	Golden flower (diploid) 3	16.191
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.477
	CNS0095605	Slightly white alabastrum(tetraploid) 2	28.193
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.990
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.540
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.314
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.144
	CNS0095610	Silvery flower (tetraploid) 1	14.539
	CNS0095611	Silvery flower (tetraploid) 2	14.438
	CNS0095612	Silvery flower (tetraploid) 3	17.026
	CNS0095613	Golden flower (tetraploid) 1	15.506
	CNS0095614	Golden flower (tetraploid) 2	17.240
	CNS0095615	Golden flower (tetraploid) 3	15.739
CRA001975	CRR073297	Stem 1	19.558
	CRR073298	Stem 2	15.574
	CRR073299	Stem 3	19.310
	CRR073300	Leaf 1	17.834
	CRR073301	Leaf 2	17.166
	CRR073302	Leaf 3	19.768
	CRR073303	Juvenile bud 1	16.954
	CRR073304	Juvenile bud 2	13.517
	CRR073305	Juvenile bud 3	13.495
	CRR073306	Third green 1	9.087
	CRR073307	Third green 2	11.713
	CRR073308	Third green 3	7.722
	CRR073309	Second white 1	16.895
	CRR073310	Second white 2	14.838
	CRR073311	Second white 3	13.845
	CRR073312	Silver flowering 1	13.456
	CRR073313	Silver flowering 2	10.250
	CRR073314	Silver flowering 3	15.651
	CRR073315	Gold flowering 1	11.014
	CRR073316	Gold flowering 2	10.223
	CRR073317	Gold flowering 3	7.036
	CRR073318	Tawny withering 1	20.878
	CRR073319	Tawny withering 2	21.282
	CRR073320	Tawny withering 3	22.033