Gene detail

Detail information of GWHGAAZE006867

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006657241.1	6.13124E-92	PREDICTED: tubulin beta-3 chain-like, partial [Oryza brachyantha]
Swissprot	tr\|Q40665\|TBB3_ORYSJ	3E-92	Tubulin beta-3 chain
trEMBL	tr\|S5FNN2\|S5FNN2_9ORYZ	4E-92	TUBB3 {ECO:0000313\|EMBL:AGQ43311.1} (Fragment)
TAIR10	AT1G20010.1	1E-72	tubulin beta-5 chain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	33244326	33244748	-
GWHAAZE00000002	mRNA	33244326	33244748	-
GWHAAZE00000002	exon	33244326	33244748	-
GWHAAZE00000002	CDS	33244326	33244748	-

Transcript Sequence
>GWHTAAZE006875 ATGAGAGAAATCCTCCATATCCAAGGTGGCCAATGTGGTAACCAAATCGGTGCCAAATTCTGGGAAGTAATTTGCGACGAACACGGAATCGATCACACAGGAAAGTACAGTGGAGATTCGGATCTTCAATTAGAGAGAATAAGCGTGTATTACAATGAGGCGAGTGGCGGTCGATACGTTCCCCGCGCTGTTCTTATGGATCTGGAGCCTGGTACAATGGATTCGTTACGATCGGGGCCGTTTGGGCAGATATTTAGGCCAGATAATTTTGTATTTGGGCAATCTGGGGCTGGTAATAATTGGGCTAAAGGGCATTATACTGAAGGAGCTGAGTTGATTGATTCTGTTCTAGATGTTGTTAGAAAGGAGGCCGAGAATTGTGATTGCATGCAGGGTAAGTTTTTTCTTGGAGAATTCTCTTGA

Network for GWHGAAZE006867

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00091.26	Tubulin	3	135	1.10E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07375	TUBB	Phagosome	map04145
K07375	TUBB	Gap junction	map04540

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0005874	cellular_component	microtubule
GO:0005200	molecular_function	structural constituent of cytoskeleton
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.374
	SRR3591706	second leaf	8.912
	SRR3591707	mature leaf	4.831
	SRR3591708	Shoot apex	8.074
	SRR3591709	Stem	17.659
	SRR3591710	White floral bud	14.313
	SRR3591711	White flower	5.559
	SRR3591712	Green floral bud	12.314
	SRR3591713	Yellow flower	3.015
SRP173429	SRR8316895	Juvenile bud stage	9.452
	SRR8316896	Juvenile bud stage	10.230
	SRR8316897	Juvenile bud stage	5.072
	SRR8316894	Third green stage	5.373
	SRR8316900	Third green stage	21.320
	SRR8316901	Third green stage	15.138
	SRR8316898	Complete white stage	2.099
	SRR8316899	Complete white stage	8.898
	SRR8316903	Complete white stage	6.458
	SRR8316902	Silver flowering stage	2.438
	SRR8316904	Silver flowering stage	3.124
	SRR8316905	Silver flowering stage	0.974
	SRR8316906	Gold flowering stage	1.369
	SRR8316907	Gold flowering stage	0.809
	SRR8316908	Gold flowering stage	2.343
SRP132670	SRR6706286	Control	23.880
	SRR6706287	Light intensity 50%	25.343
	SRR6706288	Light intensity 20%	24.938
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.699
	CNS0095593	Slightly white alabastrum(diploid) 2	6.793
	CNS0095594	Slightly white alabastrum(diploid) 3	5.504
	CNS0095595	Whole white alabastrum(diploid) 2	10.222
	CNS0095596	Whole white alabastrum(diploid) 3	10.594
	CNS0095597	Whole white alabastrum(diploid) 4	13.122
	CNS0095598	Silvery flower (diploied) 1	5.396
	CNS0095599	Silvery flower (diploied) 2	5.698
	CNS0095600	Silvery flower (diploied) 3	4.170
	CNS0095601	Golden flower (diploid) 1	4.997
	CNS0095602	Golden flower (diploid) 2	5.896
	CNS0095603	Golden flower (diploid) 3	6.533
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.497
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.479
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.325
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.213
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.122
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.783
	CNS0095610	Silvery flower (tetraploid) 1	16.360
	CNS0095611	Silvery flower (tetraploid) 2	21.966
	CNS0095612	Silvery flower (tetraploid) 3	17.264
	CNS0095613	Golden flower (tetraploid) 1	6.787
	CNS0095614	Golden flower (tetraploid) 2	15.370
	CNS0095615	Golden flower (tetraploid) 3	9.325
CRA001975	CRR073297	Stem 1	9.687
	CRR073298	Stem 2	11.431
	CRR073299	Stem 3	11.589
	CRR073300	Leaf 1	14.833
	CRR073301	Leaf 2	16.172
	CRR073302	Leaf 3	15.907
	CRR073303	Juvenile bud 1	21.337
	CRR073304	Juvenile bud 2	17.428
	CRR073305	Juvenile bud 3	14.772
	CRR073306	Third green 1	9.541
	CRR073307	Third green 2	8.465
	CRR073308	Third green 3	10.644
	CRR073309	Second white 1	1.885
	CRR073310	Second white 2	5.223
	CRR073311	Second white 3	3.030
	CRR073312	Silver flowering 1	7.996
	CRR073313	Silver flowering 2	12.674
	CRR073314	Silver flowering 3	4.029
	CRR073315	Gold flowering 1	8.547
	CRR073316	Gold flowering 2	4.643
	CRR073317	Gold flowering 3	12.906
	CRR073318	Tawny withering 1	12.831
	CRR073319	Tawny withering 2	9.423
	CRR073320	Tawny withering 3	15.967