Gene detail

Detail information of GWHGAAZE006679

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010279119.1	3.24383E-63	PREDICTED: dof zinc finger protein DOF1.5-like [Nelumbo nucifera]
Swissprot	tr\|O22967\|CDF4_ARATH	2E-53	Cyclic dof factor 4
trEMBL	tr\|W9RVG9\|W9RVG9_9ROSA	2E-63	Dof zinc finger protein {ECO:0000313\|EMBL:EXB94628.1}
TAIR10	AT2G34140.1	1E-39	Dof-type zinc finger DNA-binding family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	29869297	29869770	-
GWHAAZE00000002	mRNA	29869297	29869770	-
GWHAAZE00000002	exon	29869297	29869770	-
GWHAAZE00000002	CDS	29869297	29869770	-

Transcript Sequence
>GWHTAAZE006687 ATGACGGATGTCCACGCTGGACATGCAACAGGGATCAAGCTATTTGGCACGAGAATTGAGGTACAAGTTAAACAAGTGAAGGAAGAAGAGCAAATTAGTAAGGATGATGATGATGATCAAACGGTGGAAAAGACGAGGCCACCAGACAAGATGATAGCATGCCCTAGGTGCAAAAGTATGGACACCAAATTCTGTTACTTCAACAACTACAACGTTAACCAACCCCGCCACTTCTGTAAGGCTTGTCAGAGGTACTGGACAGCAGGCGGGGCCCTTCGCAATGTCCCCGTCGGAGCTGGTCGCCGGAGATCTAAGCCTCAGTGGGACGGTGGCGGCGGGGTCTTGGAGGGTTGCTTGTATGATGCCTCTGGCGTGCACCAGTTTGCGTTTGATGGTGTGGTGGAAGATTGGCATGTGGCGGCTCACGGAGGTTTCCGGCATGTTTTTCCGGCGAAGAGGCGGAGGAGTAGTACT

Network for GWHGAAZE006679

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	50	105	3.20E-32

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.201
	SRR3591706	second leaf	4.093
	SRR3591707	mature leaf	0.887
	SRR3591708	Shoot apex	6.853
	SRR3591709	Stem	7.349
	SRR3591710	White floral bud	4.240
	SRR3591711	White flower	3.886
	SRR3591712	Green floral bud	3.830
	SRR3591713	Yellow flower	3.143
SRP173429	SRR8316895	Juvenile bud stage	0.543
	SRR8316896	Juvenile bud stage	1.304
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.908
	SRR8316900	Third green stage	5.296
	SRR8316901	Third green stage	1.881
	SRR8316898	Complete white stage	3.177
	SRR8316899	Complete white stage	11.713
	SRR8316903	Complete white stage	4.824
	SRR8316902	Silver flowering stage	1.906
	SRR8316904	Silver flowering stage	1.875
	SRR8316905	Silver flowering stage	2.220
	SRR8316906	Gold flowering stage	1.167
	SRR8316907	Gold flowering stage	5.212
	SRR8316908	Gold flowering stage	2.326
SRP132670	SRR6706286	Control	4.889
	SRR6706287	Light intensity 50%	3.747
	SRR6706288	Light intensity 20%	3.909
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.161
	CNS0095593	Slightly white alabastrum(diploid) 2	5.375
	CNS0095594	Slightly white alabastrum(diploid) 3	4.868
	CNS0095595	Whole white alabastrum(diploid) 2	4.960
	CNS0095596	Whole white alabastrum(diploid) 3	3.169
	CNS0095597	Whole white alabastrum(diploid) 4	4.170
	CNS0095598	Silvery flower (diploied) 1	2.059
	CNS0095599	Silvery flower (diploied) 2	3.177
	CNS0095600	Silvery flower (diploied) 3	2.213
	CNS0095601	Golden flower (diploid) 1	0.275
	CNS0095602	Golden flower (diploid) 2	0.798
	CNS0095603	Golden flower (diploid) 3	0.278
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.211
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.816
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.803
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.049
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.085
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.280
	CNS0095610	Silvery flower (tetraploid) 1	4.021
	CNS0095611	Silvery flower (tetraploid) 2	1.519
	CNS0095612	Silvery flower (tetraploid) 3	0.894
	CNS0095613	Golden flower (tetraploid) 1	1.122
	CNS0095614	Golden flower (tetraploid) 2	2.959
	CNS0095615	Golden flower (tetraploid) 3	2.325
CRA001975	CRR073297	Stem 1	1.542
	CRR073298	Stem 2	2.416
	CRR073299	Stem 3	4.052
	CRR073300	Leaf 1	6.677
	CRR073301	Leaf 2	7.597
	CRR073302	Leaf 3	6.638
	CRR073303	Juvenile bud 1	14.581
	CRR073304	Juvenile bud 2	5.396
	CRR073305	Juvenile bud 3	12.359
	CRR073306	Third green 1	4.602
	CRR073307	Third green 2	12.700
	CRR073308	Third green 3	8.667
	CRR073309	Second white 1	1.590
	CRR073310	Second white 2	0.716
	CRR073311	Second white 3	0.104
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.866
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.400
	CRR073316	Gold flowering 2	0.666
	CRR073317	Gold flowering 3	0.406
	CRR073318	Tawny withering 1	16.720
	CRR073319	Tawny withering 2	2.201
	CRR073320	Tawny withering 3	17.559