Gene detail

Detail information of GWHGAAZE006602

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ACM43505.1	7.7713E-105	polyphenoloxidase [Camellia nitidissima]
Swissprot	tr\|Q9FRX6\|AS1_ANTMA	7E-89	Aureusidin synthase
trEMBL	tr\|B9VS06\|B9VS06_9ERIC	3E-105	Polyphenoloxidase {ECO:0000313\|EMBL:ACM43505.1}

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	28535400	28536068	-
GWHAAZE00000002	mRNA	28535400	28536068	-
GWHAAZE00000002	exon	28535629	28536068	-
GWHAAZE00000002	exon	28535400	28535565	-
GWHAAZE00000002	CDS	28535629	28536068	-
GWHAAZE00000002	CDS	28535400	28535565	-

Transcript Sequence
>GWHTAAZE006610 ATGGTATCAAGTGCTAAAACTCCTAGGCTTTTTCTGGGAAGTCCTTATCGAGCGGGTGACGAGCCGAACCCTGGAGCTGGCGCGCTCGAGAACATTCCTCACGGTCCTGTCCACATCTGGTCTGGTGACCGGACTCAACCCAACCTAGAAGACATGGGAAACTTCTACTCGGCTGCACGGGACCCGATATTCTATGCTCACCACTCCAATATTGATAGAATGTGGAGCATTTGGAAAACCCTAGGAGGGAGGCGCGGGGACTTCACCGACCCCGACTGGCTCAACACCTCGTTCGTGTTCTATGATGAAAATGCGGAGCTGGTACGTGTCAAAGTACGAGACTGTCTTGACCACCAAAGGCTTGGGTATGTCTACCAAGATGTGGAGACCCCGTGGCTAAATAGCCGGCCCAAACCACGTCTGACTAGAGCTTTGGAGAAAACGCTTAATGAAGTGGTCAAAGTGTTGGTGACTAGGCCAAAGAAGTCGAGGAACAAGAAGGAGAAAGAGGAAGAAGAGGAGATATTGGTGATTCAAGGGATAGAGGTGATGAGAGACGAGTTTGTGAAGTTTGACGTGTTATTAACGATGAGGATGAGTCGTTGA

Network for GWHGAAZE006602

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00264.21	Tyrosinase	30	80	2.00E-16
PF12142.9	PPO1_DWL	87	138	9.90E-30
PF12143.9	PPO1_KFDV	148	197	5.30E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00422	E1.10.3.1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Tyrosine metabolism	map00350
		Isoquinoline alkaloid biosynthesis	map00950

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity
GO:0004097	molecular_function	catechol oxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.245
	SRR3591711	White flower	4.253
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	36.507
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.111
	SRR8316901	Third green stage	0.125
	SRR8316898	Complete white stage	0.347
	SRR8316899	Complete white stage	0.139
	SRR8316903	Complete white stage	0.394
	SRR8316902	Silver flowering stage	1.728
	SRR8316904	Silver flowering stage	3.571
	SRR8316905	Silver flowering stage	0.894
	SRR8316906	Gold flowering stage	25.809
	SRR8316907	Gold flowering stage	21.098
	SRR8316908	Gold flowering stage	43.945
SRP132670	SRR6706286	Control	0.098
	SRR6706287	Light intensity 50%	0.048
	SRR6706288	Light intensity 20%	0.065
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.418
	CNS0095597	Whole white alabastrum(diploid) 4	0.067
	CNS0095598	Silvery flower (diploied) 1	0.185
	CNS0095599	Silvery flower (diploied) 2	0.198
	CNS0095600	Silvery flower (diploied) 3	0.489
	CNS0095601	Golden flower (diploid) 1	1.696
	CNS0095602	Golden flower (diploid) 2	8.216
	CNS0095603	Golden flower (diploid) 3	7.320
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.080
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.342
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.293
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	1.448
	CNS0095611	Silvery flower (tetraploid) 2	0.469
	CNS0095612	Silvery flower (tetraploid) 3	2.115
	CNS0095613	Golden flower (tetraploid) 1	19.274
	CNS0095614	Golden flower (tetraploid) 2	12.713
	CNS0095615	Golden flower (tetraploid) 3	4.395
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.085
	CRR073302	Leaf 3	0.301
	CRR073303	Juvenile bud 1	1.163
	CRR073304	Juvenile bud 2	1.791
	CRR073305	Juvenile bud 3	1.232
	CRR073306	Third green 1	1.278
	CRR073307	Third green 2	2.021
	CRR073308	Third green 3	4.677
	CRR073309	Second white 1	3.938
	CRR073310	Second white 2	7.558
	CRR073311	Second white 3	7.832
	CRR073312	Silver flowering 1	120.726
	CRR073313	Silver flowering 2	86.289
	CRR073314	Silver flowering 3	112.750
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.103
	CRR073319	Tawny withering 2	0.200
	CRR073320	Tawny withering 3	0.143